ID: 1048672275

View in Genome Browser
Species Human (GRCh38)
Location 8:136736542-136736564
Sequence TATCATAATTCTCTCAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048672275_1048672280 16 Left 1048672275 8:136736542-136736564 CCTTTTCTGAGAGAATTATGATA No data
Right 1048672280 8:136736581-136736603 ACATTTTTGGTTTTTAAAAAGGG No data
1048672275_1048672278 3 Left 1048672275 8:136736542-136736564 CCTTTTCTGAGAGAATTATGATA No data
Right 1048672278 8:136736568-136736590 TCTTTCTAGGTTAACATTTTTGG No data
1048672275_1048672279 15 Left 1048672275 8:136736542-136736564 CCTTTTCTGAGAGAATTATGATA No data
Right 1048672279 8:136736580-136736602 AACATTTTTGGTTTTTAAAAAGG No data
1048672275_1048672277 -10 Left 1048672275 8:136736542-136736564 CCTTTTCTGAGAGAATTATGATA No data
Right 1048672277 8:136736555-136736577 AATTATGATAGGTTCTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048672275 Original CRISPR TATCATAATTCTCTCAGAAA AGG (reversed) Intergenic
No off target data available for this crispr