ID: 1048672278

View in Genome Browser
Species Human (GRCh38)
Location 8:136736568-136736590
Sequence TCTTTCTAGGTTAACATTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048672275_1048672278 3 Left 1048672275 8:136736542-136736564 CCTTTTCTGAGAGAATTATGATA No data
Right 1048672278 8:136736568-136736590 TCTTTCTAGGTTAACATTTTTGG No data
1048672274_1048672278 4 Left 1048672274 8:136736541-136736563 CCCTTTTCTGAGAGAATTATGAT No data
Right 1048672278 8:136736568-136736590 TCTTTCTAGGTTAACATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048672278 Original CRISPR TCTTTCTAGGTTAACATTTT TGG Intergenic
No off target data available for this crispr