ID: 1048677056

View in Genome Browser
Species Human (GRCh38)
Location 8:136794540-136794562
Sequence ACTTAACGAAAGCGAGGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048677056_1048677059 0 Left 1048677056 8:136794540-136794562 CCAAGTCCTCGCTTTCGTTAAGT No data
Right 1048677059 8:136794563-136794585 GAAGTGAGATTTTCCCTAGGAGG No data
1048677056_1048677058 -3 Left 1048677056 8:136794540-136794562 CCAAGTCCTCGCTTTCGTTAAGT No data
Right 1048677058 8:136794560-136794582 AGTGAAGTGAGATTTTCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048677056 Original CRISPR ACTTAACGAAAGCGAGGACT TGG (reversed) Intergenic
No off target data available for this crispr