ID: 1048686954

View in Genome Browser
Species Human (GRCh38)
Location 8:136915565-136915587
Sequence TGGGACTCCTTAGGAAAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048686954_1048686964 25 Left 1048686954 8:136915565-136915587 CCCCATTTTCCTAAGGAGTCCCA No data
Right 1048686964 8:136915613-136915635 TCTCATGTGTACATTAAGAGTGG 0: 2
1: 24
2: 49
3: 113
4: 200
1048686954_1048686962 0 Left 1048686954 8:136915565-136915587 CCCCATTTTCCTAAGGAGTCCCA No data
Right 1048686962 8:136915588-136915610 GGCTATCAGAAATTATCTTAGGG No data
1048686954_1048686961 -1 Left 1048686954 8:136915565-136915587 CCCCATTTTCCTAAGGAGTCCCA No data
Right 1048686961 8:136915587-136915609 AGGCTATCAGAAATTATCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048686954 Original CRISPR TGGGACTCCTTAGGAAAATG GGG (reversed) Intergenic
No off target data available for this crispr