ID: 1048694395

View in Genome Browser
Species Human (GRCh38)
Location 8:137008904-137008926
Sequence CAGAATAAGCATGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048694395_1048694398 -5 Left 1048694395 8:137008904-137008926 CCTTCCTCCTCATGCTTATTCTG No data
Right 1048694398 8:137008922-137008944 TTCTGTTACCAAGACCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048694395 Original CRISPR CAGAATAAGCATGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr