ID: 1048700376

View in Genome Browser
Species Human (GRCh38)
Location 8:137082017-137082039
Sequence TCTGGTTACCAGGGGATGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048700376_1048700381 -2 Left 1048700376 8:137082017-137082039 CCTTGCATCCCCTGGTAACCAGA No data
Right 1048700381 8:137082038-137082060 GACAACCACCTATCTGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048700376 Original CRISPR TCTGGTTACCAGGGGATGCA AGG (reversed) Intergenic
No off target data available for this crispr