ID: 1048700488

View in Genome Browser
Species Human (GRCh38)
Location 8:137083221-137083243
Sequence GTTTTTAAGGGAATCTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048700483_1048700488 -3 Left 1048700483 8:137083201-137083223 CCTGGAAGTTTTGGACTGGGGTT No data
Right 1048700488 8:137083221-137083243 GTTTTTAAGGGAATCTTGGTGGG No data
1048700477_1048700488 2 Left 1048700477 8:137083196-137083218 CCCCTCCTGGAAGTTTTGGACTG No data
Right 1048700488 8:137083221-137083243 GTTTTTAAGGGAATCTTGGTGGG No data
1048700475_1048700488 13 Left 1048700475 8:137083185-137083207 CCTCAAATCTACCCCTCCTGGAA No data
Right 1048700488 8:137083221-137083243 GTTTTTAAGGGAATCTTGGTGGG No data
1048700478_1048700488 1 Left 1048700478 8:137083197-137083219 CCCTCCTGGAAGTTTTGGACTGG No data
Right 1048700488 8:137083221-137083243 GTTTTTAAGGGAATCTTGGTGGG No data
1048700480_1048700488 0 Left 1048700480 8:137083198-137083220 CCTCCTGGAAGTTTTGGACTGGG No data
Right 1048700488 8:137083221-137083243 GTTTTTAAGGGAATCTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048700488 Original CRISPR GTTTTTAAGGGAATCTTGGT GGG Intergenic
No off target data available for this crispr