ID: 1048707769

View in Genome Browser
Species Human (GRCh38)
Location 8:137173295-137173317
Sequence CTGGAGACACATATGGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048707769_1048707773 -4 Left 1048707769 8:137173295-137173317 CCCTTTTCCATATGTGTCTCCAG No data
Right 1048707773 8:137173314-137173336 CCAGTACATTTCTTCCCTTAAGG No data
1048707769_1048707779 26 Left 1048707769 8:137173295-137173317 CCCTTTTCCATATGTGTCTCCAG No data
Right 1048707779 8:137173344-137173366 CATGGGAGCCTTCAAAATGAGGG No data
1048707769_1048707778 25 Left 1048707769 8:137173295-137173317 CCCTTTTCCATATGTGTCTCCAG No data
Right 1048707778 8:137173343-137173365 GCATGGGAGCCTTCAAAATGAGG No data
1048707769_1048707775 9 Left 1048707769 8:137173295-137173317 CCCTTTTCCATATGTGTCTCCAG No data
Right 1048707775 8:137173327-137173349 TCCCTTAAGGCAGTGAGCATGGG No data
1048707769_1048707774 8 Left 1048707769 8:137173295-137173317 CCCTTTTCCATATGTGTCTCCAG No data
Right 1048707774 8:137173326-137173348 TTCCCTTAAGGCAGTGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048707769 Original CRISPR CTGGAGACACATATGGAAAA GGG (reversed) Intergenic
No off target data available for this crispr