ID: 1048713055 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:137233510-137233532 |
Sequence | TGCTACCTGGAGTAGTGGCT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1048713055_1048713062 | 25 | Left | 1048713055 | 8:137233510-137233532 | CCCAGCCACTACTCCAGGTAGCA | No data | ||
Right | 1048713062 | 8:137233558-137233580 | CACCATAGTTTCTCCTTTTCTGG | No data | ||||
1048713055_1048713061 | 1 | Left | 1048713055 | 8:137233510-137233532 | CCCAGCCACTACTCCAGGTAGCA | No data | ||
Right | 1048713061 | 8:137233534-137233556 | CAAAGCTGAGACAGAAGGAGAGG | No data | ||||
1048713055_1048713059 | -4 | Left | 1048713055 | 8:137233510-137233532 | CCCAGCCACTACTCCAGGTAGCA | No data | ||
Right | 1048713059 | 8:137233529-137233551 | AGCACCAAAGCTGAGACAGAAGG | 0: 1 1: 0 2: 1 3: 23 4: 205 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1048713055 | Original CRISPR | TGCTACCTGGAGTAGTGGCT GGG (reversed) | Intergenic | ||