ID: 1048713056

View in Genome Browser
Species Human (GRCh38)
Location 8:137233511-137233533
Sequence GTGCTACCTGGAGTAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048713056_1048713062 24 Left 1048713056 8:137233511-137233533 CCAGCCACTACTCCAGGTAGCAC No data
Right 1048713062 8:137233558-137233580 CACCATAGTTTCTCCTTTTCTGG No data
1048713056_1048713059 -5 Left 1048713056 8:137233511-137233533 CCAGCCACTACTCCAGGTAGCAC No data
Right 1048713059 8:137233529-137233551 AGCACCAAAGCTGAGACAGAAGG No data
1048713056_1048713061 0 Left 1048713056 8:137233511-137233533 CCAGCCACTACTCCAGGTAGCAC No data
Right 1048713061 8:137233534-137233556 CAAAGCTGAGACAGAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048713056 Original CRISPR GTGCTACCTGGAGTAGTGGC TGG (reversed) Intergenic