ID: 1048713058

View in Genome Browser
Species Human (GRCh38)
Location 8:137233523-137233545
Sequence GTCTCAGCTTTGGTGCTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048713058_1048713062 12 Left 1048713058 8:137233523-137233545 CCAGGTAGCACCAAAGCTGAGAC No data
Right 1048713062 8:137233558-137233580 CACCATAGTTTCTCCTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048713058 Original CRISPR GTCTCAGCTTTGGTGCTACC TGG (reversed) Intergenic