ID: 1048713059 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:137233529-137233551 |
Sequence | AGCACCAAAGCTGAGACAGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1048713055_1048713059 | -4 | Left | 1048713055 | 8:137233510-137233532 | CCCAGCCACTACTCCAGGTAGCA | No data | ||
Right | 1048713059 | 8:137233529-137233551 | AGCACCAAAGCTGAGACAGAAGG | No data | ||||
1048713056_1048713059 | -5 | Left | 1048713056 | 8:137233511-137233533 | CCAGCCACTACTCCAGGTAGCAC | No data | ||
Right | 1048713059 | 8:137233529-137233551 | AGCACCAAAGCTGAGACAGAAGG | No data | ||||
1048713057_1048713059 | -9 | Left | 1048713057 | 8:137233515-137233537 | CCACTACTCCAGGTAGCACCAAA | No data | ||
Right | 1048713059 | 8:137233529-137233551 | AGCACCAAAGCTGAGACAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1048713059 | Original CRISPR | AGCACCAAAGCTGAGACAGA AGG | Intergenic | ||