ID: 1048713060

View in Genome Browser
Species Human (GRCh38)
Location 8:137233533-137233555
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048713060_1048713062 2 Left 1048713060 8:137233533-137233555 CCAAAGCTGAGACAGAAGGAGAG No data
Right 1048713062 8:137233558-137233580 CACCATAGTTTCTCCTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048713060 Original CRISPR CTCTCCTTCTGTCTCAGCTT TGG (reversed) Intergenic