ID: 1048713061

View in Genome Browser
Species Human (GRCh38)
Location 8:137233534-137233556
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048713057_1048713061 -4 Left 1048713057 8:137233515-137233537 CCACTACTCCAGGTAGCACCAAA No data
Right 1048713061 8:137233534-137233556 CAAAGCTGAGACAGAAGGAGAGG No data
1048713055_1048713061 1 Left 1048713055 8:137233510-137233532 CCCAGCCACTACTCCAGGTAGCA No data
Right 1048713061 8:137233534-137233556 CAAAGCTGAGACAGAAGGAGAGG No data
1048713056_1048713061 0 Left 1048713056 8:137233511-137233533 CCAGCCACTACTCCAGGTAGCAC No data
Right 1048713061 8:137233534-137233556 CAAAGCTGAGACAGAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048713061 Original CRISPR CAAAGCTGAGACAGAAGGAG AGG Intergenic