ID: 1048713062

View in Genome Browser
Species Human (GRCh38)
Location 8:137233558-137233580
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048713057_1048713062 20 Left 1048713057 8:137233515-137233537 CCACTACTCCAGGTAGCACCAAA No data
Right 1048713062 8:137233558-137233580 CACCATAGTTTCTCCTTTTCTGG No data
1048713055_1048713062 25 Left 1048713055 8:137233510-137233532 CCCAGCCACTACTCCAGGTAGCA No data
Right 1048713062 8:137233558-137233580 CACCATAGTTTCTCCTTTTCTGG No data
1048713060_1048713062 2 Left 1048713060 8:137233533-137233555 CCAAAGCTGAGACAGAAGGAGAG No data
Right 1048713062 8:137233558-137233580 CACCATAGTTTCTCCTTTTCTGG No data
1048713058_1048713062 12 Left 1048713058 8:137233523-137233545 CCAGGTAGCACCAAAGCTGAGAC No data
Right 1048713062 8:137233558-137233580 CACCATAGTTTCTCCTTTTCTGG No data
1048713056_1048713062 24 Left 1048713056 8:137233511-137233533 CCAGCCACTACTCCAGGTAGCAC No data
Right 1048713062 8:137233558-137233580 CACCATAGTTTCTCCTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048713062 Original CRISPR CACCATAGTTTCTCCTTTTC TGG Intergenic
No off target data available for this crispr