ID: 1048714783

View in Genome Browser
Species Human (GRCh38)
Location 8:137256282-137256304
Sequence ATGAATTAGGTGGAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048714776_1048714783 24 Left 1048714776 8:137256235-137256257 CCAAATACAGTCACATTCTTAGA No data
Right 1048714783 8:137256282-137256304 ATGAATTAGGTGGAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048714783 Original CRISPR ATGAATTAGGTGGAGGTGGA TGG Intergenic
No off target data available for this crispr