ID: 1048715332

View in Genome Browser
Species Human (GRCh38)
Location 8:137262308-137262330
Sequence CCTGATAACCTGACGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048715323_1048715332 21 Left 1048715323 8:137262264-137262286 CCTTAGGAGATGAGACTATTTTA No data
Right 1048715332 8:137262308-137262330 CCTGATAACCTGACGGTGGGGGG No data
1048715322_1048715332 27 Left 1048715322 8:137262258-137262280 CCGAGACCTTAGGAGATGAGACT No data
Right 1048715332 8:137262308-137262330 CCTGATAACCTGACGGTGGGGGG No data
1048715325_1048715332 -3 Left 1048715325 8:137262288-137262310 CCAGCTGGTGCTAAAATATACCT No data
Right 1048715332 8:137262308-137262330 CCTGATAACCTGACGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048715332 Original CRISPR CCTGATAACCTGACGGTGGG GGG Intergenic
No off target data available for this crispr