ID: 1048715690

View in Genome Browser
Species Human (GRCh38)
Location 8:137266095-137266117
Sequence CAGTAAAAAGAGAGGCCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048715690_1048715696 10 Left 1048715690 8:137266095-137266117 CCTCCGGGCCTCTCTTTTTACTG No data
Right 1048715696 8:137266128-137266150 AATCTTTCATATTAAAATCAAGG No data
1048715690_1048715697 11 Left 1048715690 8:137266095-137266117 CCTCCGGGCCTCTCTTTTTACTG No data
Right 1048715697 8:137266129-137266151 ATCTTTCATATTAAAATCAAGGG No data
1048715690_1048715698 21 Left 1048715690 8:137266095-137266117 CCTCCGGGCCTCTCTTTTTACTG No data
Right 1048715698 8:137266139-137266161 TTAAAATCAAGGGTTAAGAGAGG No data
1048715690_1048715699 22 Left 1048715690 8:137266095-137266117 CCTCCGGGCCTCTCTTTTTACTG No data
Right 1048715699 8:137266140-137266162 TAAAATCAAGGGTTAAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048715690 Original CRISPR CAGTAAAAAGAGAGGCCCGG AGG (reversed) Intergenic
No off target data available for this crispr