ID: 1048716292

View in Genome Browser
Species Human (GRCh38)
Location 8:137273927-137273949
Sequence CCACCCCAATCAATTTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048716292_1048716295 -4 Left 1048716292 8:137273927-137273949 CCTTGAGAAATTGATTGGGGTGG No data
Right 1048716295 8:137273946-137273968 GTGGAAAATGGCAACAGAAGAGG No data
1048716292_1048716296 6 Left 1048716292 8:137273927-137273949 CCTTGAGAAATTGATTGGGGTGG No data
Right 1048716296 8:137273956-137273978 GCAACAGAAGAGGAAAATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048716292 Original CRISPR CCACCCCAATCAATTTCTCA AGG (reversed) Intergenic
No off target data available for this crispr