ID: 1048726231

View in Genome Browser
Species Human (GRCh38)
Location 8:137388068-137388090
Sequence CACAATGCTGATAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048726231_1048726236 22 Left 1048726231 8:137388068-137388090 CCCATATCACTATCAGCATTGTG No data
Right 1048726236 8:137388113-137388135 CTAGGAAGTTCCAAACTTTCCGG No data
1048726231_1048726234 4 Left 1048726231 8:137388068-137388090 CCCATATCACTATCAGCATTGTG No data
Right 1048726234 8:137388095-137388117 AAGCCATTCAACAAGTCTCTAGG 0: 1428
1: 1886
2: 1423
3: 807
4: 580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048726231 Original CRISPR CACAATGCTGATAGTGATAT GGG (reversed) Intergenic
No off target data available for this crispr