ID: 1048726234

View in Genome Browser
Species Human (GRCh38)
Location 8:137388095-137388117
Sequence AAGCCATTCAACAAGTCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6124
Summary {0: 1428, 1: 1886, 2: 1423, 3: 807, 4: 580}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048726232_1048726234 3 Left 1048726232 8:137388069-137388091 CCATATCACTATCAGCATTGTGG 0: 10
1: 991
2: 1687
3: 1534
4: 1097
Right 1048726234 8:137388095-137388117 AAGCCATTCAACAAGTCTCTAGG 0: 1428
1: 1886
2: 1423
3: 807
4: 580
1048726230_1048726234 29 Left 1048726230 8:137388043-137388065 CCTTTGCTTTTCTTGGATTTTAT No data
Right 1048726234 8:137388095-137388117 AAGCCATTCAACAAGTCTCTAGG 0: 1428
1: 1886
2: 1423
3: 807
4: 580
1048726231_1048726234 4 Left 1048726231 8:137388068-137388090 CCCATATCACTATCAGCATTGTG No data
Right 1048726234 8:137388095-137388117 AAGCCATTCAACAAGTCTCTAGG 0: 1428
1: 1886
2: 1423
3: 807
4: 580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048726234 Original CRISPR AAGCCATTCAACAAGTCTCT AGG Intergenic
Too many off-targets to display for this crispr