ID: 1048726236

View in Genome Browser
Species Human (GRCh38)
Location 8:137388113-137388135
Sequence CTAGGAAGTTCCAAACTTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048726232_1048726236 21 Left 1048726232 8:137388069-137388091 CCATATCACTATCAGCATTGTGG 0: 10
1: 991
2: 1687
3: 1534
4: 1097
Right 1048726236 8:137388113-137388135 CTAGGAAGTTCCAAACTTTCCGG No data
1048726231_1048726236 22 Left 1048726231 8:137388068-137388090 CCCATATCACTATCAGCATTGTG No data
Right 1048726236 8:137388113-137388135 CTAGGAAGTTCCAAACTTTCCGG No data
1048726235_1048726236 -8 Left 1048726235 8:137388098-137388120 CCATTCAACAAGTCTCTAGGAAG 0: 1383
1: 2003
2: 1318
3: 803
4: 605
Right 1048726236 8:137388113-137388135 CTAGGAAGTTCCAAACTTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048726236 Original CRISPR CTAGGAAGTTCCAAACTTTC CGG Intergenic
No off target data available for this crispr