ID: 1048731562

View in Genome Browser
Species Human (GRCh38)
Location 8:137447457-137447479
Sequence CTTGTCTCTCCCATCCCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048731557_1048731562 30 Left 1048731557 8:137447404-137447426 CCTGTTGCTTTATGCTCTTCTTG No data
Right 1048731562 8:137447457-137447479 CTTGTCTCTCCCATCCCAGTTGG No data
1048731558_1048731562 7 Left 1048731558 8:137447427-137447449 CCATCTACAGATCTCTTCTCTCC No data
Right 1048731562 8:137447457-137447479 CTTGTCTCTCCCATCCCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048731562 Original CRISPR CTTGTCTCTCCCATCCCAGT TGG Intergenic
No off target data available for this crispr