ID: 1048739763

View in Genome Browser
Species Human (GRCh38)
Location 8:137542153-137542175
Sequence GCTTATTTATTAGCTCTAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048739762_1048739763 22 Left 1048739762 8:137542108-137542130 CCAACTGATGTTTTATGTTGATT No data
Right 1048739763 8:137542153-137542175 GCTTATTTATTAGCTCTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048739763 Original CRISPR GCTTATTTATTAGCTCTAAT AGG Intergenic
No off target data available for this crispr