ID: 1048744638

View in Genome Browser
Species Human (GRCh38)
Location 8:137600234-137600256
Sequence ATTATCCATCTGGCCAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048744638_1048744641 0 Left 1048744638 8:137600234-137600256 CCAAATTTGGCCAGATGGATAAT No data
Right 1048744641 8:137600257-137600279 TGTGAAAGGATGCTCAAACAAGG No data
1048744638_1048744642 1 Left 1048744638 8:137600234-137600256 CCAAATTTGGCCAGATGGATAAT No data
Right 1048744642 8:137600258-137600280 GTGAAAGGATGCTCAAACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048744638 Original CRISPR ATTATCCATCTGGCCAAATT TGG (reversed) Intergenic
No off target data available for this crispr