ID: 1048746466

View in Genome Browser
Species Human (GRCh38)
Location 8:137619778-137619800
Sequence ACCTTCCACCTGAAGAACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048746466_1048746468 -2 Left 1048746466 8:137619778-137619800 CCCTAGTTCTTCAGGTGGAAGGT No data
Right 1048746468 8:137619799-137619821 GTGCACATTTAATCCACAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048746466 Original CRISPR ACCTTCCACCTGAAGAACTA GGG (reversed) Intergenic
No off target data available for this crispr