ID: 1048750610

View in Genome Browser
Species Human (GRCh38)
Location 8:137669765-137669787
Sequence ATTTGCTGGTACAAGTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048750610_1048750614 -4 Left 1048750610 8:137669765-137669787 CCACCACACTTGTACCAGCAAAT No data
Right 1048750614 8:137669784-137669806 AAATGCTGAGTGGAAAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048750610 Original CRISPR ATTTGCTGGTACAAGTGTGG TGG (reversed) Intergenic
No off target data available for this crispr