ID: 1048753065

View in Genome Browser
Species Human (GRCh38)
Location 8:137701559-137701581
Sequence TAGTTTAACCACAGTGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048753065_1048753069 9 Left 1048753065 8:137701559-137701581 CCAGATTCACTGTGGTTAAACTA No data
Right 1048753069 8:137701591-137701613 GAGCTAGAATCAATGAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048753065 Original CRISPR TAGTTTAACCACAGTGAATC TGG (reversed) Intergenic
No off target data available for this crispr