ID: 1048754084

View in Genome Browser
Species Human (GRCh38)
Location 8:137715773-137715795
Sequence GCTCAAATTAAATAAAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048754084_1048754085 -9 Left 1048754084 8:137715773-137715795 CCACTTTTTTATTTAATTTGAGC No data
Right 1048754085 8:137715787-137715809 AATTTGAGCCTTCTATTGATTGG No data
1048754084_1048754088 16 Left 1048754084 8:137715773-137715795 CCACTTTTTTATTTAATTTGAGC No data
Right 1048754088 8:137715812-137715834 AATGCCCGTTCACAGTGGTGAGG No data
1048754084_1048754087 11 Left 1048754084 8:137715773-137715795 CCACTTTTTTATTTAATTTGAGC No data
Right 1048754087 8:137715807-137715829 TGGATAATGCCCGTTCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048754084 Original CRISPR GCTCAAATTAAATAAAAAAG TGG (reversed) Intergenic
No off target data available for this crispr