ID: 1048754085

View in Genome Browser
Species Human (GRCh38)
Location 8:137715787-137715809
Sequence AATTTGAGCCTTCTATTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048754084_1048754085 -9 Left 1048754084 8:137715773-137715795 CCACTTTTTTATTTAATTTGAGC No data
Right 1048754085 8:137715787-137715809 AATTTGAGCCTTCTATTGATTGG No data
1048754083_1048754085 -2 Left 1048754083 8:137715766-137715788 CCTTTTTCCACTTTTTTATTTAA No data
Right 1048754085 8:137715787-137715809 AATTTGAGCCTTCTATTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048754085 Original CRISPR AATTTGAGCCTTCTATTGAT TGG Intergenic
No off target data available for this crispr