ID: 1048760778

View in Genome Browser
Species Human (GRCh38)
Location 8:137792685-137792707
Sequence AGGCTTGGACTGCTAATGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048760778_1048760779 -9 Left 1048760778 8:137792685-137792707 CCAGTCATTAGCAGTCCAAGCCT No data
Right 1048760779 8:137792699-137792721 TCCAAGCCTTTATTGTACTAAGG No data
1048760778_1048760787 29 Left 1048760778 8:137792685-137792707 CCAGTCATTAGCAGTCCAAGCCT No data
Right 1048760787 8:137792737-137792759 GATACGAAGGGCAGTATGCAGGG No data
1048760778_1048760782 16 Left 1048760778 8:137792685-137792707 CCAGTCATTAGCAGTCCAAGCCT No data
Right 1048760782 8:137792724-137792746 GTCGTGTGACCCAGATACGAAGG No data
1048760778_1048760786 28 Left 1048760778 8:137792685-137792707 CCAGTCATTAGCAGTCCAAGCCT No data
Right 1048760786 8:137792736-137792758 AGATACGAAGGGCAGTATGCAGG No data
1048760778_1048760788 30 Left 1048760778 8:137792685-137792707 CCAGTCATTAGCAGTCCAAGCCT No data
Right 1048760788 8:137792738-137792760 ATACGAAGGGCAGTATGCAGGGG No data
1048760778_1048760783 17 Left 1048760778 8:137792685-137792707 CCAGTCATTAGCAGTCCAAGCCT No data
Right 1048760783 8:137792725-137792747 TCGTGTGACCCAGATACGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048760778 Original CRISPR AGGCTTGGACTGCTAATGAC TGG (reversed) Intergenic
No off target data available for this crispr