ID: 1048760779

View in Genome Browser
Species Human (GRCh38)
Location 8:137792699-137792721
Sequence TCCAAGCCTTTATTGTACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048760777_1048760779 -1 Left 1048760777 8:137792677-137792699 CCATATGGCCAGTCATTAGCAGT No data
Right 1048760779 8:137792699-137792721 TCCAAGCCTTTATTGTACTAAGG No data
1048760775_1048760779 6 Left 1048760775 8:137792670-137792692 CCCACTGCCATATGGCCAGTCAT No data
Right 1048760779 8:137792699-137792721 TCCAAGCCTTTATTGTACTAAGG No data
1048760778_1048760779 -9 Left 1048760778 8:137792685-137792707 CCAGTCATTAGCAGTCCAAGCCT No data
Right 1048760779 8:137792699-137792721 TCCAAGCCTTTATTGTACTAAGG No data
1048760774_1048760779 10 Left 1048760774 8:137792666-137792688 CCTGCCCACTGCCATATGGCCAG No data
Right 1048760779 8:137792699-137792721 TCCAAGCCTTTATTGTACTAAGG No data
1048760776_1048760779 5 Left 1048760776 8:137792671-137792693 CCACTGCCATATGGCCAGTCATT No data
Right 1048760779 8:137792699-137792721 TCCAAGCCTTTATTGTACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048760779 Original CRISPR TCCAAGCCTTTATTGTACTA AGG Intergenic
No off target data available for this crispr