ID: 1048760788

View in Genome Browser
Species Human (GRCh38)
Location 8:137792738-137792760
Sequence ATACGAAGGGCAGTATGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048760778_1048760788 30 Left 1048760778 8:137792685-137792707 CCAGTCATTAGCAGTCCAAGCCT No data
Right 1048760788 8:137792738-137792760 ATACGAAGGGCAGTATGCAGGGG No data
1048760781_1048760788 10 Left 1048760781 8:137792705-137792727 CCTTTATTGTACTAAGGTAGTCG No data
Right 1048760788 8:137792738-137792760 ATACGAAGGGCAGTATGCAGGGG No data
1048760780_1048760788 15 Left 1048760780 8:137792700-137792722 CCAAGCCTTTATTGTACTAAGGT No data
Right 1048760788 8:137792738-137792760 ATACGAAGGGCAGTATGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048760788 Original CRISPR ATACGAAGGGCAGTATGCAG GGG Intergenic
No off target data available for this crispr