ID: 1048765274

View in Genome Browser
Species Human (GRCh38)
Location 8:137836820-137836842
Sequence CTGTGTTGGGGGAAGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048765274_1048765282 -9 Left 1048765274 8:137836820-137836842 CCCTCTCCCTTCCCCCAACACAG No data
Right 1048765282 8:137836834-137836856 CCAACACAGACACTCATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048765274 Original CRISPR CTGTGTTGGGGGAAGGGAGA GGG (reversed) Intergenic
No off target data available for this crispr