ID: 1048766423

View in Genome Browser
Species Human (GRCh38)
Location 8:137849001-137849023
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048766421_1048766423 14 Left 1048766421 8:137848964-137848986 CCATCGGGGTGAGGCAACATCTC No data
Right 1048766423 8:137849001-137849023 CTGTGACTCTTCAGGACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048766423 Original CRISPR CTGTGACTCTTCAGGACAAA TGG Intergenic
No off target data available for this crispr