ID: 1048778119

View in Genome Browser
Species Human (GRCh38)
Location 8:137970105-137970127
Sequence GAGTAAAAACAGATGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048778115_1048778119 18 Left 1048778115 8:137970064-137970086 CCATTATTCCACAAACAATAATG No data
Right 1048778119 8:137970105-137970127 GAGTAAAAACAGATGGTAGAGGG No data
1048778114_1048778119 19 Left 1048778114 8:137970063-137970085 CCCATTATTCCACAAACAATAAT No data
Right 1048778119 8:137970105-137970127 GAGTAAAAACAGATGGTAGAGGG No data
1048778116_1048778119 10 Left 1048778116 8:137970072-137970094 CCACAAACAATAATGAATCGTTA No data
Right 1048778119 8:137970105-137970127 GAGTAAAAACAGATGGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048778119 Original CRISPR GAGTAAAAACAGATGGTAGA GGG Intergenic
No off target data available for this crispr