ID: 1048780101 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:137990714-137990736 |
| Sequence | AGTAAGCTCAAAGGGGGTTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1048780101_1048780109 | 28 | Left | 1048780101 | 8:137990714-137990736 | CCACAACCCCCTTTGAGCTTACT | No data | ||
| Right | 1048780109 | 8:137990765-137990787 | CTCCTTGAAGGACAGTTTTATGG | No data | ||||
| 1048780101_1048780108 | 16 | Left | 1048780101 | 8:137990714-137990736 | CCACAACCCCCTTTGAGCTTACT | No data | ||
| Right | 1048780108 | 8:137990753-137990775 | ATTCAGAGATTTCTCCTTGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1048780101 | Original CRISPR | AGTAAGCTCAAAGGGGGTTG TGG (reversed) | Intergenic | ||