ID: 1048780101

View in Genome Browser
Species Human (GRCh38)
Location 8:137990714-137990736
Sequence AGTAAGCTCAAAGGGGGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048780101_1048780109 28 Left 1048780101 8:137990714-137990736 CCACAACCCCCTTTGAGCTTACT No data
Right 1048780109 8:137990765-137990787 CTCCTTGAAGGACAGTTTTATGG No data
1048780101_1048780108 16 Left 1048780101 8:137990714-137990736 CCACAACCCCCTTTGAGCTTACT No data
Right 1048780108 8:137990753-137990775 ATTCAGAGATTTCTCCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048780101 Original CRISPR AGTAAGCTCAAAGGGGGTTG TGG (reversed) Intergenic