ID: 1048784194

View in Genome Browser
Species Human (GRCh38)
Location 8:138033241-138033263
Sequence GGGGGCCAGTGCAAGATCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048784194_1048784200 0 Left 1048784194 8:138033241-138033263 CCCTTGATCTTGCACTGGCCCCC No data
Right 1048784200 8:138033264-138033286 AGTCCAGCGTGAAACAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048784194 Original CRISPR GGGGGCCAGTGCAAGATCAA GGG (reversed) Intergenic
No off target data available for this crispr