ID: 1048787262

View in Genome Browser
Species Human (GRCh38)
Location 8:138063470-138063492
Sequence GAGTGAGACCAGAGTGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 287}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048787255_1048787262 17 Left 1048787255 8:138063430-138063452 CCACACACAGCATCAAGGGAGGG 0: 1
1: 0
2: 2
3: 20
4: 213
Right 1048787262 8:138063470-138063492 GAGTGAGACCAGAGTGGAGTGGG 0: 1
1: 0
2: 3
3: 29
4: 287
1048787253_1048787262 18 Left 1048787253 8:138063429-138063451 CCCACACACAGCATCAAGGGAGG 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1048787262 8:138063470-138063492 GAGTGAGACCAGAGTGGAGTGGG 0: 1
1: 0
2: 3
3: 29
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048787262 Original CRISPR GAGTGAGACCAGAGTGGAGT GGG Intergenic
900286105 1:1901438-1901460 GAGTGAGAGCAGAGGTGACTGGG + Intergenic
901591117 1:10344030-10344052 GAGTGAGCACAGGGTGGGGTGGG - Intronic
903288998 1:22295969-22295991 GTGTGAGACCAGACTGGCTTGGG - Intergenic
904612956 1:31735345-31735367 GAATGAGCCCCGAGTGGGGTGGG + Intronic
905536043 1:38722560-38722582 GACTCAGACCAGAGCGGACTGGG + Intergenic
905550383 1:38833238-38833260 GAGTGGGAGCAGGGTGGGGTGGG - Intergenic
905804525 1:40866138-40866160 GAGTGTGGACAGAGTGCAGTGGG + Intergenic
906670883 1:47653761-47653783 AAATGAGGCCATAGTGGAGTAGG - Intergenic
908266298 1:62382520-62382542 CAGTGATCCCAGAGTGGGGTAGG + Intergenic
908988570 1:70056487-70056509 GCGTGAGGGCAGAGTGGAATGGG - Intronic
909084616 1:71155973-71155995 GAGTGAGAGCACAGTGGCGGTGG - Intergenic
909137640 1:71821536-71821558 GAGTGAAACCAGAGTAGAAAGGG + Intronic
910976178 1:92908544-92908566 GAGAGAAGCCAGACTGGAGTAGG + Intronic
911438127 1:97888696-97888718 CAGAGAGACCAGAGAGAAGTGGG + Intronic
913326993 1:117636004-117636026 GAGTGAGAACTGAGTGGGCTGGG + Intergenic
913612600 1:120523179-120523201 GAGTGAGAGCTGAGAGGAGAGGG + Intergenic
914578591 1:148999069-148999091 GAGTGAGAGCTGAGAGGAGAGGG - Intronic
915648508 1:157290824-157290846 GAGTGAGAGGAGAGGGGACTGGG + Intergenic
916015846 1:160749371-160749393 GAGTGAGCACAGAGTAGAGAAGG + Intronic
916785515 1:168084402-168084424 GTGGGAAAACAGAGTGGAGTTGG - Exonic
917139269 1:171818489-171818511 GAGTGGGAGGAGAGTGAAGTGGG - Intergenic
917140677 1:171832397-171832419 GAGAGAGACAAGAGTGGAGAGGG - Intergenic
917563949 1:176192007-176192029 GGATGAGACCACAATGGAGTAGG + Intronic
917720452 1:177782031-177782053 GAATGAGACCTGAGTGAAGGGGG + Intergenic
918232425 1:182548468-182548490 GTGAAAGGCCAGAGTGGAGTGGG - Intronic
918302483 1:183216679-183216701 GAGTGAGAACACAGAGGGGTGGG - Intronic
918597998 1:186315752-186315774 GAGTGAGAACAGAGAGTAGCAGG - Intronic
919882125 1:201907660-201907682 GACAGAGGCCAGGGTGGAGTGGG + Intronic
920680712 1:208070357-208070379 GGGTGAGGTCAGAGAGGAGTGGG - Intronic
920868762 1:209775574-209775596 GAGGGAGATCAGAGAGGAGAGGG - Intronic
922022099 1:221715927-221715949 GAGGGAGAGAAGAGTGGAGAAGG - Intronic
922555882 1:226531614-226531636 GAGTGGGGCCAGCGTGTAGTGGG + Intergenic
1064125866 10:12659349-12659371 GAGTGAGACCAGAGGGAGTTGGG + Intronic
1065046828 10:21753105-21753127 GAGTGAGACCTGACTGGAGCTGG - Intergenic
1069663854 10:70142065-70142087 GAGTTAGACTGGACTGGAGTTGG + Intronic
1070514689 10:77193717-77193739 GAGTGGTCCCAGAGTGGGGTTGG - Intronic
1074058883 10:109946827-109946849 GAGTGAGAGTGGAGTGGAGAAGG + Intronic
1074558011 10:114509662-114509684 GATTGAGACCAGACTGCAGAGGG - Intronic
1074964975 10:118482895-118482917 GAATAAGACCACAGTGGACTGGG + Intergenic
1075153434 10:119955402-119955424 GGCTGAGGCCAGAGTGCAGTGGG + Intergenic
1075713205 10:124541790-124541812 GTTGGAGACCAGAGTGGAGTGGG + Intronic
1076334749 10:129698189-129698211 GAGAGAGACCAGAATGCAGAGGG + Intronic
1078251071 11:9617010-9617032 CAGTGTGACAGGAGTGGAGTGGG + Intergenic
1078664422 11:13312965-13312987 CAGTGAGACCGGGGTGGAGAGGG + Intronic
1079238623 11:18706714-18706736 GGGTGAGACTAAAGTGGAGGTGG - Intronic
1080569029 11:33539382-33539404 AAGTGATACCAGAGTAGATTTGG - Intergenic
1084273549 11:68040941-68040963 GAGGGAGGCCAGAGTGAAGGTGG + Intronic
1084344615 11:68537917-68537939 GAGTGGGACTAAAGTGAAGTGGG + Intronic
1085415081 11:76314282-76314304 ATGTGAAACCAGAGTGGAATGGG + Intergenic
1086134078 11:83429563-83429585 GGGTGAGATCAGAGAGGAGAAGG + Intergenic
1087014857 11:93544699-93544721 GAGTGGGATCAGAGGGGATTGGG + Intergenic
1087822901 11:102731463-102731485 GAGTGAGAACAGAATCTAGTGGG - Intergenic
1089624819 11:119744703-119744725 GAGTGAGACATAGGTGGAGTGGG + Intergenic
1090329102 11:125916182-125916204 GAGAGAGACCAGAGGGAAATCGG - Intronic
1090429453 11:126634003-126634025 GAATGAGACCTGAGTGCACTGGG + Intronic
1090430339 11:126640900-126640922 GAGAGACATCAGAGTAGAGTCGG - Intronic
1090481548 11:127073387-127073409 GTGTGTGACTAGAGTGGGGTTGG + Intergenic
1091030749 11:132185781-132185803 GAGAGAGCCCAGGATGGAGTAGG + Intronic
1092320101 12:7462924-7462946 GAATGAGAGCAGAGTGAAGGGGG + Intronic
1093531003 12:20163664-20163686 GTGTTAAATCAGAGTGGAGTAGG + Intergenic
1093828444 12:23724973-23724995 GAATTAGACCAGAATGGTGTTGG + Intronic
1095192090 12:39269866-39269888 GTGTGAGGCCAGAGGGGAATGGG - Intergenic
1096519138 12:52174309-52174331 GGGAGTGACCAGGGTGGAGTGGG + Intronic
1096534064 12:52259570-52259592 GGGTGAGACCATTGTGGAGGAGG - Intronic
1098109859 12:67110920-67110942 GAGTGAGACTAGGGTCAAGTAGG + Intergenic
1099437575 12:82661950-82661972 TGCTGAGAGCAGAGTGGAGTGGG + Intergenic
1100052012 12:90460415-90460437 GAATGAGAGCTGAGTGGAGGGGG - Intergenic
1100193491 12:92218185-92218207 AAGTGAGAACAGAGTGGAGAAGG + Intergenic
1102039614 12:109792496-109792518 GGGTGGGACCAGGGTGGAGATGG - Intronic
1102146428 12:110658330-110658352 CAGTGAGGCCACACTGGAGTAGG - Intronic
1102262732 12:111454537-111454559 GAGTGAGACCAGGTTGAACTTGG - Intronic
1102609431 12:114098493-114098515 GAGTGACAGCACAGTCGAGTAGG + Intergenic
1102955189 12:117054417-117054439 GAGAGAGGCCAGTGTGGTGTGGG - Intronic
1103070303 12:117935799-117935821 TTGTGTGACCAGAGTGGAGTGGG - Intronic
1103586904 12:121962916-121962938 TGGTGAGGCCAGAGTGGAATGGG + Intronic
1103950492 12:124548410-124548432 AGGTGTGACCAGAGTGGACTGGG + Intronic
1104747682 12:131220303-131220325 GAGTGAGAGGGGAGTGGGGTGGG - Intergenic
1106003030 13:25742643-25742665 GAGAGAGAGAAAAGTGGAGTGGG - Intronic
1108959330 13:56203872-56203894 GAGTGAGAAGATAGTGGAGAAGG - Intergenic
1112130112 13:96514209-96514231 CAGTGATACCAGCGTGCAGTAGG + Intronic
1112193805 13:97204712-97204734 GAGTGAGGCCAAAATGGATTGGG - Intergenic
1113835753 13:113327561-113327583 GAGTGAGCACACAGTGAAGTCGG + Intronic
1117513251 14:56473643-56473665 GAGAGGGACGAGAGTGGATTTGG - Intergenic
1119392441 14:74300121-74300143 GAGTGAGCCCAGACTAGAGGAGG - Intronic
1119405373 14:74395442-74395464 GAGTGTGAAAAGAGTGGATTTGG + Intergenic
1119615951 14:76099323-76099345 GAGTGAGGCCGGAGCGGAGTCGG - Intergenic
1119995154 14:79245398-79245420 GAGAGAGAGAAGAGAGGAGTAGG + Intronic
1121211393 14:92210388-92210410 GGGTGAGAGGACAGTGGAGTTGG - Intergenic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1122388906 14:101367187-101367209 AATTGAGCCCAGAGTGGCGTGGG + Intergenic
1123696625 15:22883413-22883435 GAGAGAGACCCCTGTGGAGTGGG + Intronic
1124364364 15:29061871-29061893 GACTGAGACAAGAGTGGCATGGG + Intronic
1124618470 15:31260063-31260085 GAGAGAAACCAGACTGCAGTGGG + Intergenic
1124641719 15:31400140-31400162 GAGGGAGAGCAGAGTGGGGGTGG - Intronic
1125841834 15:42809137-42809159 GAGTGAGAACAGAGGGCAGGTGG - Intronic
1127350824 15:58150190-58150212 GGGTAAGGCCACAGTGGAGTGGG - Intronic
1128112057 15:65082660-65082682 CAATGAGGCCAGAGAGGAGTGGG - Intergenic
1130048065 15:80461415-80461437 GAGTGAGAAGAGAATGGAGGAGG + Intronic
1130220859 15:82018375-82018397 CAGTCAAACCATAGTGGAGTAGG + Intergenic
1130306195 15:82713587-82713609 GAGTGAGGGTAGAGGGGAGTAGG - Intergenic
1130379714 15:83360936-83360958 GAATGAGAGCAGAGTGAAGGGGG - Intergenic
1131082148 15:89545935-89545957 GTGTGAGAACTGAGTGGTGTAGG - Intergenic
1131198582 15:90377094-90377116 AAGTCAGCCCAGAATGGAGTTGG - Intergenic
1131290374 15:91101581-91101603 CAGTGAGAGCAGAGAGGAGGAGG + Intronic
1133430222 16:5730356-5730378 GAATGAGCCTAGAGTGGAGCCGG + Intergenic
1133748960 16:8709734-8709756 GAGTGAGAAAAGCGTGGACTTGG + Intronic
1134532049 16:14990695-14990717 GAGTAAGCCCAGGGGGGAGTGGG - Intronic
1134637111 16:15800766-15800788 GAGAGAGAACTGATTGGAGTTGG - Intronic
1135985518 16:27181013-27181035 GATTGAGACCAGAGGGCAGTGGG + Intergenic
1137441355 16:48501230-48501252 GAGTGCGCACAGAGTGGGGTGGG + Intergenic
1138513400 16:57521850-57521872 GAGAGAGGCCAGTGTGGTGTGGG - Intronic
1138513676 16:57523890-57523912 GAGAGAGGCCAGTGTGGTGTGGG + Intronic
1139497150 16:67327937-67327959 GAGGGAAACCAGATTGGAGTGGG + Intronic
1139863974 16:70049964-70049986 GAGTAAGCCCAGGGGGGAGTGGG + Intergenic
1139964474 16:70737898-70737920 GAGGGAGGCCGGAGTGGAGCAGG - Intronic
1140037553 16:71382797-71382819 GTGTGAGGCCAGAGTGGCGGTGG + Intronic
1140424539 16:74849726-74849748 GAGAGAGAGCGAAGTGGAGTGGG + Intergenic
1144968050 17:19090006-19090028 CAATGAGACCAGAGAGGACTGGG + Intergenic
1144979867 17:19162057-19162079 CAATGAGACCAGAGAGGACTGGG - Intergenic
1144988355 17:19216175-19216197 CAATGAGACCAGAGAGGACTGGG + Intronic
1145872672 17:28288338-28288360 GAGTGAAAGCAGAGTAGGGTTGG - Intergenic
1145995895 17:29104770-29104792 GAGTGAGAACAGAGTCAAGGGGG + Intronic
1146619999 17:34389702-34389724 GCGTGAAACCAGAATGGAATTGG + Intergenic
1146662839 17:34676036-34676058 GAGGGAGACCAGAGAGGAAGAGG + Intergenic
1146840792 17:36152799-36152821 GAGGGAGACCAAATTGGAGCTGG + Intergenic
1147542842 17:41375374-41375396 GAGTGAGGCCAAAGAGGGGTAGG - Intronic
1148008714 17:44456783-44456805 GAATGAAAACAGAGTAGAGTTGG - Intronic
1148109781 17:45137859-45137881 GAGTGGGAGCACAGTGGGGTGGG - Intronic
1148678057 17:49456533-49456555 CAGCGTGACCAGAGTGGAGGGGG - Intronic
1149598173 17:57876096-57876118 GAGGGAGATCAGATTTGAGTGGG - Intronic
1149644882 17:58233141-58233163 GAGTGAGTTCAGAGCGGAGTCGG - Intronic
1149775654 17:59354892-59354914 CAGTGAGAGAAGAGAGGAGTTGG + Intronic
1151248992 17:72819163-72819185 GAATGAGATCATAATGGAGTAGG + Intronic
1151665932 17:75545153-75545175 GAGTGAGGCTAGGGTGGAGCTGG + Intronic
1151796772 17:76351859-76351881 GAGGGAGAGCAGAGGGGAGCAGG - Intronic
1151991053 17:77574532-77574554 GAGAGAGGACAGAGTGGAGCAGG - Intergenic
1154150519 18:11902936-11902958 GAGTGAGCTCAGTGGGGAGTTGG - Intronic
1156228116 18:35129033-35129055 GAGTGAGAAGAGAGAGGAATAGG + Intronic
1156267498 18:35501733-35501755 TAGTGAGACCAGAGGAGGGTGGG - Intergenic
1157426143 18:47585944-47585966 GTGAGGGACCAGCGTGGAGTAGG - Intergenic
1157698037 18:49739240-49739262 CAGGCAGACCAGAGTGAAGTTGG + Intergenic
1161250466 19:3277103-3277125 AAGAAAGACCAGAGTGGAGTCGG - Intronic
1162363948 19:10236577-10236599 GAGTGAGAGAACAGTGGAGGAGG + Intergenic
1162575590 19:11497070-11497092 GGGGGAGACCTGAGTGAAGTGGG - Intronic
1163689880 19:18732710-18732732 GAGTGCCACCAGTGGGGAGTTGG + Intronic
1163844526 19:19630725-19630747 AAGTGAGACCAAAGAGGAGTGGG + Intronic
1163844852 19:19632771-19632793 AAGTGATACCAAAGAGGAGTGGG - Intronic
1165088366 19:33367450-33367472 GAGACAGAACAGAGTGGTGTTGG - Intergenic
1166328896 19:42067543-42067565 GAGAGAGGCAGGAGTGGAGTGGG + Intronic
925868125 2:8246579-8246601 GAGGGAGACCAGAGTGCAGTGGG - Intergenic
927485027 2:23482712-23482734 GAGAGAGACAGGGGTGGAGTTGG - Intronic
927887115 2:26725382-26725404 AAGTGAGCCCAGAGAGGGGTAGG + Intronic
927980264 2:27370504-27370526 TAGGGAGCCCAAAGTGGAGTTGG - Exonic
928964738 2:36966033-36966055 GAGTGAGAACAGGGTCGAGGTGG + Intronic
933703634 2:85273846-85273868 GAGTGGGGGCAGAGTGGCGTGGG + Intronic
934962376 2:98687990-98688012 GAGTCAGACAAGGGTGGAGGAGG - Intronic
935466666 2:103406353-103406375 GAGGGAGGCTAGTGTGGAGTGGG - Intergenic
939995810 2:148918477-148918499 GAGTGATACCTGGGTGGGGTTGG + Intronic
940488246 2:154324099-154324121 GTGTGGGAAAAGAGTGGAGTAGG - Intronic
940987631 2:160064164-160064186 GAGAGAGACTAGGCTGGAGTGGG + Intergenic
944915003 2:204350742-204350764 GAATAAGACAATAGTGGAGTTGG + Intergenic
945756648 2:213855702-213855724 GAATGAGAGCAGAGTGGAGGGGG + Intronic
946858453 2:223977008-223977030 GAATGAGAGCCGAGTGAAGTGGG - Intronic
947261162 2:228223957-228223979 GAGAGAGAACAAAGTGGAGAAGG - Intergenic
947996838 2:234534996-234535018 GAGTGAAACCAGAAGGGAGAGGG - Intergenic
1169679597 20:8196010-8196032 GAATGAGAGCAGAGTGAAGTGGG + Intronic
1170457557 20:16547597-16547619 GAGTGAGACCAGAGGCAGGTGGG - Intronic
1170792179 20:19517369-19517391 CAGTGAGTCCAGAGGGGAGATGG - Intronic
1170843909 20:19946196-19946218 AAGTCTGACCAGAGTGGAATGGG + Intronic
1172166071 20:32900121-32900143 GGGTGAGGCCAGGGTGGGGTTGG + Intronic
1173527270 20:43742836-43742858 GACAGAGACCAGAAGGGAGTTGG - Intergenic
1173599129 20:44280257-44280279 AAGTGAGACCCGACTGGGGTGGG - Exonic
1174543919 20:51310904-51310926 GAGAGAGAGAAGAATGGAGTGGG + Intergenic
1174900253 20:54492184-54492206 AAGTGAGACCAGTCTGGGGTTGG - Intronic
1175155489 20:56968273-56968295 GAGTGAGAATAAAGTGGAGGAGG - Intergenic
1175901778 20:62362778-62362800 GAGGAAGACCAGGGTGGAGAGGG + Intronic
1176378382 21:6098670-6098692 GAGTGAGACCATACTGGAGTAGG + Intergenic
1176992654 21:15517422-15517444 TAGTGGGGGCAGAGTGGAGTGGG + Intergenic
1178141600 21:29690229-29690251 AAGTGAGACCAGCAGGGAGTTGG - Intronic
1179228287 21:39476101-39476123 GATGGAGACCAGAGTGGGGGTGG + Intronic
1179745090 21:43439562-43439584 GAGTGAGACCATACTGGAGTAGG - Intergenic
1180247188 21:46555849-46555871 GAGTGAGCTCAGACGGGAGTGGG - Intronic
1182055037 22:27345967-27345989 GAGTGAGAGCAGCCTGGAGTGGG - Intergenic
1182309025 22:29391685-29391707 GAATGAGAACAGAGTTGCGTAGG + Intronic
1182521667 22:30888118-30888140 GAGTGAGGCCAGATGGGGGTTGG + Intronic
1182794447 22:32980644-32980666 GATTGAGATCCGAGTGGAGCAGG - Exonic
1183281356 22:36934328-36934350 GAAGGAGGCCTGAGTGGAGTGGG - Intronic
1183598482 22:38826422-38826444 GAAAGAGCCCAGTGTGGAGTGGG + Intronic
1184542560 22:45137973-45137995 GAATGAGACTAGAGTGCACTGGG + Intergenic
1184656411 22:45944177-45944199 GAGACGGACAAGAGTGGAGTGGG - Intronic
1184828297 22:46968152-46968174 GAGTTAGACCTGCCTGGAGTTGG + Intronic
1185080536 22:48707237-48707259 GAGTGAGGCCAGGCTGGAGATGG - Intronic
1185179018 22:49348710-49348732 GAGGGAAACCAGAGTGGGCTTGG + Intergenic
949930498 3:9074614-9074636 CAGTGAGCCCAGGGTGGAGCTGG + Intronic
950126270 3:10511625-10511647 CAGTGGGATCTGAGTGGAGTTGG - Intronic
952255104 3:31688205-31688227 GTGTGAGACCAGAGGGAGGTGGG - Intronic
952516823 3:34112869-34112891 GACAGAGGCCAGACTGGAGTGGG - Intergenic
952873785 3:37924997-37925019 AGGTGAGACCAGAGTGGGGAAGG - Intronic
954715360 3:52524146-52524168 GACAGAGACCAGGGTGGGGTTGG - Exonic
955154799 3:56406371-56406393 GAGTCAGACCAGAGTAGGGAGGG + Intronic
956154284 3:66278400-66278422 GAGTGGAACCAGAATGGAGAGGG - Intronic
956256256 3:67286171-67286193 GTGTGGGACCAGTGTGGATTTGG - Intergenic
956694481 3:71906905-71906927 GAGAGGGAACAGAGAGGAGTAGG + Intergenic
956745903 3:72310896-72310918 GAGGGAGACAAAGGTGGAGTTGG + Intergenic
957382584 3:79452126-79452148 GAGTGAGACAAAGGTGGATTTGG - Intronic
959406834 3:105971085-105971107 GAATGAGAGCAGAGTGAAGGGGG + Intergenic
960267351 3:115635468-115635490 GAGTGAAACCAGTATGGAGGAGG + Intronic
960950986 3:122998249-122998271 GAGCGACCCCAGAGTGAAGTGGG - Intronic
961352141 3:126310920-126310942 GAGAGAGAGCAGGGTGGAGATGG - Intergenic
963000863 3:140680337-140680359 GAATGAGACCAGAGTGAGGCAGG - Intronic
964199367 3:154100799-154100821 GAGTGAGTCAAGCGTGGAGACGG - Intergenic
965890257 3:173504660-173504682 GTGTGAAACCAGACTGGAGTGGG - Intronic
966916230 3:184585592-184585614 CAGAGAGACCTGAATGGAGTTGG - Intronic
967171045 3:186824066-186824088 AAGTGAGGTCAGAGTGGAGGAGG - Intergenic
968094476 3:195918568-195918590 GAGAGAGAGTAGAGTAGAGTAGG - Intergenic
968453797 4:687258-687280 GAGGGAGGCCAAAGTGGAGCGGG + Intronic
969417879 4:7073016-7073038 GAGAGGAACCAGAGTGGAGAAGG - Intergenic
969652286 4:8474923-8474945 GAGGGACATCAGAGTGGGGTGGG - Intronic
970099661 4:12505616-12505638 GAGTGAGAAAAGAGTGAAGGAGG - Intergenic
970953272 4:21781016-21781038 GGGTCAGACCAGAGTGGTGTGGG - Intronic
972272341 4:37523354-37523376 GAGTGAGAGAAGGGTGGTGTTGG + Intronic
972325375 4:38010580-38010602 GAGGGAGTGCAGAGTGGAGAAGG - Intronic
973783771 4:54316093-54316115 GAGTGAGAACAGATTGCAGCAGG - Intergenic
978625532 4:110680647-110680669 GAGTTAGAACAGAGGGGAGCAGG + Intergenic
979203307 4:118005203-118005225 GAATGAGAACTGAGTGAAGTGGG + Intergenic
980993217 4:139757006-139757028 GTCTGAGACCAGAGCGCAGTGGG - Intronic
982112852 4:152072272-152072294 GTGTGAGGCCAGAGTTGTGTGGG - Intergenic
984693414 4:182754736-182754758 GACTGTTACCAGAGTGGAGATGG + Exonic
984752026 4:183287115-183287137 GAATGAGACCAGAGTGGCCCTGG - Intronic
985271392 4:188197473-188197495 GAGTGAGAAGGGGGTGGAGTGGG - Intergenic
986055536 5:4133051-4133073 GAGACACCCCAGAGTGGAGTGGG + Intergenic
986521841 5:8627729-8627751 GAGTGAGCGCAGAGTGAAGGGGG + Intergenic
986823498 5:11495852-11495874 GAGTGGGAGCAGAGAGGAGCTGG - Intronic
988430345 5:31111648-31111670 GAGTGGTACCAGGGTGTAGTAGG + Intergenic
989144345 5:38234045-38234067 GAATGAGAACAGAGTGAAGGGGG - Intergenic
990241646 5:53822127-53822149 AAGTGAGACCTGAGTCCAGTTGG - Intergenic
990902929 5:60772636-60772658 GAGAGGGAGGAGAGTGGAGTTGG - Intronic
991174710 5:63673717-63673739 GAGTGAGACCAGAAAGGAGGAGG + Intergenic
991178911 5:63725743-63725765 GTGTGAGAAGAGAGTGAAGTGGG + Intergenic
992233771 5:74687244-74687266 GAGTAAAAGCACAGTGGAGTTGG + Intronic
992311141 5:75499968-75499990 GAATGAGATAACAGTGGAGTAGG + Intronic
994102953 5:95914199-95914221 GAGTGAGACCAGAGTTCTGATGG + Intronic
995229274 5:109740274-109740296 GAGTGAGAGAAGAGAGGAGCTGG + Intronic
995458286 5:112375193-112375215 GAGTGAGCCCAGAGTGGTGCAGG + Intronic
995632895 5:114153295-114153317 GAGTGAGAACAAAGTGGAGGTGG - Intergenic
996603763 5:125296717-125296739 TAATGAGACCAGTGTGGAGGAGG + Intergenic
997843367 5:137262807-137262829 GAATAAAACCAGAGTGGAATGGG + Intronic
998431000 5:142069905-142069927 TAGTGAGACCAGAGTGGGTAAGG + Intergenic
1000040254 5:157479976-157479998 GAGTGTGACCAGAGTAGACTTGG - Exonic
1002845044 6:938449-938471 GTGTGAGACCCCAGTGGAGGAGG - Intergenic
1003406314 6:5829739-5829761 GACTGAGATCAGAGTTGAGCGGG - Intergenic
1003533489 6:6956480-6956502 GAGTGGAACCATAGTGGAGTTGG - Intergenic
1004048869 6:12053632-12053654 GACTGAAACCAAAGTGGAGGTGG + Intronic
1004280758 6:14277674-14277696 GAGTGAGAGCAGGGAAGAGTAGG - Intergenic
1005494208 6:26374697-26374719 TAGTGAGAGGAGAATGGAGTGGG + Intronic
1005822297 6:29607891-29607913 CAGTGAGGCCAGAGTGCAGCTGG - Intronic
1013224239 6:108108516-108108538 TAATGATACAAGAGTGGAGTTGG - Intronic
1016303391 6:142656439-142656461 GAGTGAGACCTGCGTGGGGCAGG + Intergenic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017553645 6:155539581-155539603 GAGTTTGACCACAGTGCAGTGGG + Intergenic
1017726186 6:157277459-157277481 GAGTGGGACCAGAGGAGAGAAGG - Intergenic
1017908208 6:158771215-158771237 GCGTGAGGCCAGAGTGGGGGGGG - Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018110724 6:160534751-160534773 GGGTGAGACCAGAGGAGACTGGG + Intronic
1018362695 6:163087643-163087665 GAGTGAGACCAGAGGAGAGGAGG + Intronic
1018362721 6:163087775-163087797 GAGTGAGACCAGAGGAGAGGAGG + Intronic
1019382275 7:730195-730217 GACTGGGAGAAGAGTGGAGTCGG + Intronic
1020080603 7:5283896-5283918 GAGTGAGGCCAGACTGGCTTTGG + Intronic
1021287912 7:18805300-18805322 GACTGTTACCAGAGTGGGGTAGG + Intronic
1021527525 7:21605459-21605481 CAGGGAGAGCAGAGTTGAGTTGG + Intronic
1021800931 7:24305639-24305661 GAGCGAGGGCAGAGTGGAGCTGG + Intergenic
1023857870 7:44196184-44196206 GAGTGAGGCCAGAGAGGAGCAGG + Intronic
1025610596 7:63072901-63072923 GAATCAGGGCAGAGTGGAGTTGG - Intergenic
1026612696 7:71874726-71874748 GAGTGAGACAAGACTGGTCTAGG + Intronic
1029421973 7:100476601-100476623 GAGGGTGACCACTGTGGAGTGGG - Intronic
1029448599 7:100628143-100628165 GTGGGTGACCAGTGTGGAGTGGG + Intronic
1029514506 7:101017262-101017284 GGGTGAGGTCAGAGTGGAGCGGG - Intronic
1030339438 7:108360174-108360196 GATTCAGACAATAGTGGAGTAGG + Intronic
1031449017 7:121891002-121891024 GAGTGAGGGGAGAGTGGAGTGGG - Intronic
1032406964 7:131663352-131663374 GAGTCATACTAGAGTAGAGTGGG - Intergenic
1033800944 7:144901474-144901496 GAGAGAGTGCAGAGGGGAGTGGG + Intergenic
1034194301 7:149234158-149234180 TACTGAGACCAGGCTGGAGTTGG + Intergenic
1034226595 7:149489656-149489678 GAGTGAGAGAAAAGTGGAGGTGG + Intronic
1034241652 7:149615908-149615930 GAGTGAGAGAAAAGTGGAGGAGG + Intergenic
1034890510 7:154835168-154835190 AAGTGAGGCCATACTGGAGTAGG + Intronic
1035863821 8:3059712-3059734 GAGAGAGAGGAGAGTGGACTGGG + Intronic
1036757339 8:11480047-11480069 GAGTGAGAGCAGGGAGGAGGAGG - Intergenic
1037287704 8:17318741-17318763 GAGTGAGGACAGATTGGAGTGGG - Intronic
1037299507 8:17436010-17436032 CAGGGAGACCAGGGTTGAGTGGG - Intergenic
1038420431 8:27430822-27430844 GAGTGAGACCTGGGAGGAGCAGG + Intronic
1038659672 8:29486319-29486341 GATGCAGACCAGAGTGGAGAAGG + Intergenic
1038725198 8:30076105-30076127 GAGTTAGAACAGTGTGGAGTTGG - Intronic
1041760612 8:61362256-61362278 GAGTCAGCCCAAAGTGGAGAAGG + Intronic
1043144399 8:76634231-76634253 GAATGAGAGCAGAGTGAAGGTGG - Intergenic
1046463312 8:114570545-114570567 GAGTGAGACCAGAGATGCGCTGG - Intergenic
1046491911 8:114964659-114964681 GGGAGAGACCAGAGGAGAGTAGG + Intergenic
1047392874 8:124467981-124468003 AAGTGACACTAGAGTGCAGTGGG - Intergenic
1048091319 8:131243573-131243595 GAGTGAGACAAGAGTGGGAACGG + Intergenic
1048346036 8:133575215-133575237 GAGAGAGAACAGAGCGGAGAGGG - Intergenic
1048787262 8:138063470-138063492 GAGTGAGACCAGAGTGGAGTGGG + Intergenic
1049466252 8:142752460-142752482 GGGTGAGAGCACAGAGGAGTGGG - Exonic
1049663927 8:143834774-143834796 GACTGAGCCAGGAGTGGAGTGGG + Exonic
1057416040 9:94863127-94863149 TAGAGAGGCCAGGGTGGAGTGGG + Intronic
1059948941 9:119441965-119441987 GAGTCAGACCAGGGTGAAGCTGG + Intergenic
1061716238 9:132520131-132520153 GAGTGAGAGGAGAGGGGAGGGGG - Intronic
1186061941 X:5718492-5718514 GAATGAGACCAGAGTGCATCTGG + Intergenic
1189221836 X:39378819-39378841 GATTGAAAACACAGTGGAGTGGG - Intergenic
1189375060 X:40460080-40460102 TAGTGAGCCCGGAGTGGTGTGGG + Intergenic
1190279497 X:48919740-48919762 GGGTGAGCCCAGAGTGGTGGTGG + Intergenic
1190326965 X:49212490-49212512 CAGTGAGACCAGAGGTGTGTTGG + Intronic
1190578668 X:51869035-51869057 GAGTGAGAGCAGAGTTGATGTGG + Intronic
1192051079 X:67724533-67724555 GAGTGACCCCAGAGCTGAGTTGG + Exonic
1192596197 X:72410933-72410955 GAGTGAGAGAAGAGTGAGGTGGG - Intronic
1194365382 X:93007570-93007592 GAGTGAGAGCTGAGTGAAGGAGG + Intergenic
1196266563 X:113654816-113654838 AAGTCAGAAAAGAGTGGAGTAGG + Intergenic
1196408222 X:115388290-115388312 TAGTGAGCCCAGAGTAGAATAGG + Intergenic
1197083107 X:122441607-122441629 GGGTGGGACTAGTGTGGAGTGGG + Intergenic
1199928577 X:152494988-152495010 GAATGAGAGCAGAGCGAAGTGGG - Intergenic
1200154054 X:153965914-153965936 GGGTGGGACCAGAGTGCAGTGGG - Intronic
1200374693 X:155767518-155767540 GAGGGAGACCAAGGTGGAGGCGG + Intergenic