ID: 1048787603

View in Genome Browser
Species Human (GRCh38)
Location 8:138066961-138066983
Sequence TTGGAGAAGCAGAAGCAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048787595_1048787603 12 Left 1048787595 8:138066926-138066948 CCTTTGACAGCATCAGAGGCTGG No data
Right 1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048787603 Original CRISPR TTGGAGAAGCAGAAGCAGAA GGG Intergenic
No off target data available for this crispr