ID: 1048793082

View in Genome Browser
Species Human (GRCh38)
Location 8:138122353-138122375
Sequence ATAGTCCTGTGTCTTCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048793082_1048793085 12 Left 1048793082 8:138122353-138122375 CCACTGAGAAGACACAGGACTAT No data
Right 1048793085 8:138122388-138122410 TCTCACAGAGACAGAAGTTAGGG No data
1048793082_1048793084 11 Left 1048793082 8:138122353-138122375 CCACTGAGAAGACACAGGACTAT No data
Right 1048793084 8:138122387-138122409 ATCTCACAGAGACAGAAGTTAGG No data
1048793082_1048793087 30 Left 1048793082 8:138122353-138122375 CCACTGAGAAGACACAGGACTAT No data
Right 1048793087 8:138122406-138122428 TAGGGATCTAAGGAAGCTGCAGG No data
1048793082_1048793086 20 Left 1048793082 8:138122353-138122375 CCACTGAGAAGACACAGGACTAT No data
Right 1048793086 8:138122396-138122418 AGACAGAAGTTAGGGATCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048793082 Original CRISPR ATAGTCCTGTGTCTTCTCAG TGG (reversed) Intergenic
No off target data available for this crispr