ID: 1048793087

View in Genome Browser
Species Human (GRCh38)
Location 8:138122406-138122428
Sequence TAGGGATCTAAGGAAGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048793082_1048793087 30 Left 1048793082 8:138122353-138122375 CCACTGAGAAGACACAGGACTAT No data
Right 1048793087 8:138122406-138122428 TAGGGATCTAAGGAAGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048793087 Original CRISPR TAGGGATCTAAGGAAGCTGC AGG Intergenic
No off target data available for this crispr