ID: 1048800955

View in Genome Browser
Species Human (GRCh38)
Location 8:138193482-138193504
Sequence TCTTCAGCCTGATCTCGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048800950_1048800955 30 Left 1048800950 8:138193429-138193451 CCACACCCAGAAGGAAAGAGAGT 0: 1
1: 0
2: 7
3: 36
4: 389
Right 1048800955 8:138193482-138193504 TCTTCAGCCTGATCTCGTGATGG No data
1048800953_1048800955 25 Left 1048800953 8:138193434-138193456 CCCAGAAGGAAAGAGAGTGGGCG 0: 1
1: 0
2: 1
3: 19
4: 266
Right 1048800955 8:138193482-138193504 TCTTCAGCCTGATCTCGTGATGG No data
1048800954_1048800955 24 Left 1048800954 8:138193435-138193457 CCAGAAGGAAAGAGAGTGGGCGT 0: 1
1: 0
2: 1
3: 7
4: 158
Right 1048800955 8:138193482-138193504 TCTTCAGCCTGATCTCGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048800955 Original CRISPR TCTTCAGCCTGATCTCGTGA TGG Intronic
No off target data available for this crispr