ID: 1048804630

View in Genome Browser
Species Human (GRCh38)
Location 8:138228658-138228680
Sequence AAGAGCAACCAGAAGTTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048804630_1048804635 23 Left 1048804630 8:138228658-138228680 CCCCACAACTTCTGGTTGCTCTT 0: 1
1: 0
2: 0
3: 11
4: 220
Right 1048804635 8:138228704-138228726 AAACCTCAAGCAGTATCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048804630 Original CRISPR AAGAGCAACCAGAAGTTGTG GGG (reversed) Intronic
905026722 1:34855550-34855572 AGGAGCAGCCAGTATTTGTGTGG + Exonic
905174191 1:36125779-36125801 AAGAGCCTCCCGAAGCTGTGTGG + Intergenic
905324244 1:37139261-37139283 CAGGGAAACCAGAAGATGTGGGG + Intergenic
905402344 1:37712868-37712890 GAGAGAAGCCAGAAGTTGTTTGG - Intergenic
906271135 1:44479756-44479778 TAGAGAACCCAGAATTTGTGGGG - Intronic
907594459 1:55706403-55706425 ATGAGCAACCAGGCTTTGTGTGG + Intergenic
907792020 1:57676151-57676173 TACAGCATGCAGAAGTTGTGTGG + Intronic
908264843 1:62368326-62368348 GAAAGCAACCATCAGTTGTGAGG - Intergenic
909047567 1:70728454-70728476 AACAGCATCCAGGAGCTGTGTGG - Intergenic
909187316 1:72504003-72504025 TGGAACAAACAGAAGTTGTGAGG - Intergenic
909553586 1:76927945-76927967 AAGAGTAACCACATGTTGTAGGG + Intronic
911613154 1:99979244-99979266 CAGAGCAACCAGATGGAGTGAGG - Intronic
911685279 1:100768732-100768754 AAGATCATCCATAAGTTGGGAGG + Intergenic
911689004 1:100809933-100809955 AACAGCAACCAGCAGTTGAATGG + Intergenic
911702604 1:100971465-100971487 GAGAACAACCACAGGTTGTGAGG + Intronic
915043195 1:152985483-152985505 AAGACCAAGCAGAAGTAATGTGG + Exonic
915047736 1:153032598-153032620 AAGACCAAGCAGAAGTAATGTGG + Exonic
915876444 1:159616219-159616241 AAGAGCGAGCAGAAGTAGGGTGG + Intergenic
916536945 1:165712152-165712174 AAAAGCAGCTAGAATTTGTGGGG + Intergenic
917498679 1:175566047-175566069 TAGAGCAACAAGGAGTTTTGTGG - Intronic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
918698544 1:187577480-187577502 AAGAGCAAACAGAACTATTGAGG - Intergenic
922159727 1:223070239-223070261 ATGGGCAACCAGAAGTTCTTGGG + Intergenic
924777453 1:247119848-247119870 AAGAGCCAGAAGAAGTTCTGTGG + Intergenic
1063505055 10:6590274-6590296 AAGAACAAGCAGGAGTGGTGAGG + Intergenic
1063521550 10:6745964-6745986 AAGATCAACCAGAAGTCTCGGGG + Intergenic
1064591007 10:16890811-16890833 CAGGGCAACTAGAAGTTATGAGG - Intronic
1068493531 10:57755262-57755284 AAAAGCAAACAGAAATTGTCAGG - Intergenic
1069294808 10:66830583-66830605 AAGAGAAATTAGTAGTTGTGAGG - Intronic
1070023629 10:72610610-72610632 AACAGCTGACAGAAGTTGTGTGG + Intronic
1071719877 10:88132179-88132201 AAGGGCAACAAGAGGTTCTGAGG + Intergenic
1074597763 10:114882990-114883012 AAGAGCAGCCAGGAGATGGGCGG + Intronic
1076431763 10:130408844-130408866 AAAAGCAGCCAGGAGTTCTGGGG + Intergenic
1076508348 10:130993772-130993794 AGGAGCCACCAGAAGCTGGGGGG - Intergenic
1078061003 11:8043982-8044004 AAGAGCAGCCAGAAGAAGGGGGG - Intronic
1085080738 11:73632113-73632135 AAGAGCAAACAGAAGGTTGGAGG + Intergenic
1086390849 11:86361204-86361226 AAGAACCACCAGAAGTAGAGAGG + Intergenic
1087321445 11:96664641-96664663 ATGAGAAACCATAAGTTGGGTGG + Intergenic
1088769070 11:113015040-113015062 AAGAGAAACTAGAAATGGTGAGG - Intronic
1089686892 11:120156599-120156621 GAGAACAACCAGAGGCTGTGGGG - Intronic
1090674013 11:128972498-128972520 CAGAGCAGCCACCAGTTGTGGGG - Exonic
1091307119 11:134543308-134543330 AAGTGCAAGCAGATGTTATGCGG - Intergenic
1091942675 12:4502618-4502640 AAGGGCGAGCAGAATTTGTGAGG - Intronic
1093191365 12:16078660-16078682 ATGAGCAATGAGAAGTAGTGGGG + Intergenic
1095380643 12:41586871-41586893 CAGAGTAACCAGAATTTTTGTGG + Intergenic
1096420759 12:51455407-51455429 AGGGGCAACTGGAAGTTGTGTGG + Intronic
1099013235 12:77316941-77316963 AAGAGCTATAAGCAGTTGTGTGG - Intergenic
1099329186 12:81260698-81260720 AAGACCAACAATAAATTGTGTGG + Exonic
1100333079 12:93603740-93603762 AAGGGCACGCAGCAGTTGTGTGG + Intergenic
1102028157 12:109725194-109725216 AATAGCAGCCAGCATTTGTGGGG + Intronic
1102804056 12:115763606-115763628 AAGAGCATTCAGAAATTATGAGG - Intergenic
1103196608 12:119048942-119048964 AATTGCATCAAGAAGTTGTGAGG + Intronic
1105429951 13:20327229-20327251 CAGAGCTGCCAGAAGTTGTTAGG + Intergenic
1108708953 13:53014982-53015004 AACAGCAACCAGAGGCTCTGTGG + Intergenic
1111518552 13:89367224-89367246 AGGAGCAACAGGGAGTTGTGAGG - Intergenic
1111665421 13:91261725-91261747 AATAGAAACCAGGAGTTGTTGGG - Intergenic
1111813216 13:93118348-93118370 AAGAGGAACAAGAAGTCTTGTGG + Intergenic
1112499349 13:99930542-99930564 AAGAGAAAACAAAAGTTCTGAGG + Intergenic
1116324367 14:43513130-43513152 AAGAGCAACCAGGAGTTCTTGGG - Intergenic
1116747042 14:48833455-48833477 AAGAGCTAAAAGAAGATGTGGGG + Intergenic
1116874459 14:50097231-50097253 AGGAGCAACCAGACGCTGGGCGG + Intergenic
1119046050 14:71320228-71320250 CATAGCAACCAGAAGTTCCGCGG + Intergenic
1120141935 14:80939394-80939416 AAGAGCAACTCGGAGTTTTGGGG - Exonic
1122685266 14:103501412-103501434 AAGTGCCACCAGCTGTTGTGGGG + Intronic
1123472157 15:20563172-20563194 AAGAGGAACCAGAAATGGGGTGG - Intergenic
1123645845 15:22437181-22437203 AAGAGGAACCAGAAATGGGGTGG + Intergenic
1123732462 15:23158163-23158185 AAGAGGAACCAGAAATGGGGTGG - Intergenic
1123750597 15:23355545-23355567 AAGAGGAACCAGAAATGGGGTGG - Intronic
1124282966 15:28379461-28379483 AAGAGGAACCAGAAATGGGGTGG - Intronic
1124299733 15:28532152-28532174 AAGAGGAACCAGAAATGGGGTGG + Intronic
1124464852 15:29927866-29927888 AAGACCAACCAGAAGTTGGCAGG + Intronic
1124892422 15:33745457-33745479 AAGAGCAGCCAGGAGTCTTGGGG + Intronic
1125332039 15:38591929-38591951 CAGGACAACCAGAAGTTGGGGGG - Intergenic
1126001386 15:44213383-44213405 AAAAGCAATCAGATGCTGTGGGG + Intergenic
1126852859 15:52808221-52808243 AAGAGAAAACTGAAGTTCTGAGG - Intergenic
1128588075 15:68868803-68868825 AAGAGCAATCAGAAATTATCTGG - Intronic
1130667889 15:85885200-85885222 AAGAACACCCAGAAGTCATGGGG + Intergenic
1132372601 15:101308816-101308838 AAGAGAAACCAGAGGGTCTGTGG - Intronic
1132937355 16:2487924-2487946 AACAGCAGCCAGCAGCTGTGGGG + Intronic
1135066789 16:19316915-19316937 AAGAACAACCAGATGTTCAGTGG + Intronic
1135816004 16:25634347-25634369 AAAAGTAACAAGAAGTTGAGTGG + Intergenic
1140208650 16:72953729-72953751 AAGATCAGCCAGACGTAGTGGGG - Intronic
1141116913 16:81316413-81316435 AAGAGAAACCAGAAGTTACAAGG - Intronic
1141244404 16:82292800-82292822 AAGAGCAACCAGCAGACCTGAGG - Intergenic
1141671472 16:85494252-85494274 AGAAGCCACCAGAAGTTGGGAGG - Intergenic
1142418661 16:89957057-89957079 GAAAGCAACCAGAAGTGCTGGGG + Intronic
1143111259 17:4554274-4554296 AACAGCTGCCAGGAGTTGTGTGG + Exonic
1143919742 17:10321526-10321548 AACAGCAAACAGATGATGTGAGG - Exonic
1148343573 17:46888662-46888684 ATGAGCAACCAGACAGTGTGGGG - Intergenic
1148742331 17:49899825-49899847 AAGAGAAACCAGTTGTTTTGAGG + Intergenic
1151128027 17:71866152-71866174 AAGAGCAACAAGGGGTTGTGAGG - Intergenic
1151773022 17:76177347-76177369 AAGAGCAAGCAGAAGCTAGGCGG - Intronic
1153146685 18:2040744-2040766 AAAAGAAACCAGAAATTGTTTGG + Intergenic
1155256504 18:24002335-24002357 AAGAGCAACTAAAAGAAGTGGGG + Intronic
1155373703 18:25133287-25133309 GGGAGCAAACAGAAGTAGTGAGG - Intronic
1156099931 18:33580230-33580252 AAGAGGAAACTTAAGTTGTGGGG + Intronic
1157990090 18:52484698-52484720 AAGAGCAAAAAGAAATTGAGTGG + Intronic
1158228237 18:55222903-55222925 AGAGGCAACCAGAAGTGGTGGGG + Intronic
1159325335 18:66908209-66908231 AAGAGAAACCAGGAGTTTTAAGG - Intergenic
1159516742 18:69469149-69469171 AATGGCAACCAGCAATTGTGGGG + Intronic
1163910158 19:20182421-20182443 CAGAACAAACAGAAGCTGTGGGG - Intronic
1164276660 19:23724618-23724640 AAGAGACATCAGAAGGTGTGGGG - Intergenic
1164776043 19:30854527-30854549 AACAGCAACCACCAGTTGTCAGG + Intergenic
927869920 2:26616864-26616886 AAGAGCAAACAGAAGTCTTGGGG + Intronic
928170575 2:29000592-29000614 AAGAGCAATAAGAAGTCTTGAGG + Intronic
928263385 2:29788084-29788106 AAGAGCAGACAGAGGCTGTGAGG - Intronic
929386754 2:41416979-41417001 CAGAGCCAACAGAAGATGTGGGG + Intergenic
931525895 2:63152566-63152588 AAGAGTAACCAGATGTTGGCAGG - Intronic
932749095 2:74359922-74359944 AAGTGCCACCAGAAGTTGCTTGG + Intronic
932775425 2:74525482-74525504 AAGAGCACCCAGGTGTGGTGGGG - Exonic
934897596 2:98132303-98132325 AAGACCAACCAGAAGCCATGGGG - Intronic
935676620 2:105599945-105599967 AACAGCAAACGTAAGTTGTGGGG + Intergenic
937630127 2:124092032-124092054 AGGGGCCACCAGAAGTGGTGTGG - Intronic
938729370 2:134134408-134134430 GAGAGCAACAAGGATTTGTGGGG - Intronic
939257520 2:139763814-139763836 AAGAGCAGGCAGAAGGGGTGAGG + Intergenic
940894211 2:159064759-159064781 CAGAGTAAGCAGAAGTTTTGTGG - Intronic
943560029 2:189450316-189450338 AAGAGCAACAAGCTCTTGTGTGG + Intronic
943868231 2:192957488-192957510 AAAAGAAACCAGAACTTGTCTGG - Intergenic
944929306 2:204500422-204500444 TAGCGGAACAAGAAGTTGTGGGG + Intergenic
947525956 2:230876932-230876954 AGGAGCTCCCAGAAGTTGCGAGG - Exonic
947589044 2:231374346-231374368 AGAAGAAACCAGAAGATGTGAGG - Intronic
948173354 2:235924319-235924341 AAGAGCAGCCAGAAAGTATGAGG - Intronic
1170701296 20:18706066-18706088 AAAAGCTATCAGCAGTTGTGTGG + Intronic
1173182628 20:40816233-40816255 GAGAGCCACCAGCAGTTGTTAGG - Intergenic
1173270122 20:41526449-41526471 AAGAGCCACCAGCTCTTGTGAGG + Intronic
1174300200 20:49576154-49576176 ATGAGAAGCCAGAAGTTCTGAGG - Intergenic
1174399832 20:50270043-50270065 AAGAGCACCCAGGAGAGGTGGGG - Intergenic
1175171500 20:57084570-57084592 GAGAGAAAGCAGAGGTTGTGCGG - Intergenic
1176272918 20:64245858-64245880 AAGACCAACGAGAAGTGCTGCGG + Intergenic
1177642366 21:23860415-23860437 AATAGTAAACAAAAGTTGTGTGG + Intergenic
1177673954 21:24272331-24272353 AATAGAAATCAGAGGTTGTGAGG + Intergenic
1178587493 21:33882318-33882340 AAGAGCAACAAGGAGCTGTATGG + Exonic
1181282760 22:21731567-21731589 AAGAGGAACCAGAAAAGGTGAGG + Intronic
1181671846 22:24429182-24429204 ATGAGGAACCAGAAGATGTGTGG + Intronic
949655288 3:6210916-6210938 CAGAGCATCCAAAAGCTGTGGGG + Intergenic
949798426 3:7877058-7877080 AATAGCAACAGGAAATTGTGTGG + Intergenic
950178043 3:10889804-10889826 CAGAGGAAGCAGAAGTTCTGGGG + Intronic
951532906 3:23714360-23714382 AAGGGCATACAGAAGTTCTGGGG + Intergenic
951748965 3:26012618-26012640 CAGATCAGCCAGAAGGTGTGCGG - Intergenic
952820519 3:37482070-37482092 CAGTGCAGCCAGAAGCTGTGTGG - Intronic
953056019 3:39387804-39387826 GAGAGAAACCAGAAACTGTGAGG + Intronic
954898401 3:53996998-53997020 AAGAGCAACCAATAAATGTGGGG + Intergenic
956032214 3:65050693-65050715 AAGAGAAAGCAGAAGTTGCAAGG - Intergenic
956953948 3:74315197-74315219 AAGAGGAACCCTAAGTTCTGAGG + Intronic
959303611 3:104632350-104632372 AAGAGCAACGAGTAGGTTTGGGG - Intergenic
960636476 3:119789684-119789706 CCGAGGAAACAGAAGTTGTGAGG - Intronic
961048633 3:123727277-123727299 CAGACCACCCAGAAGGTGTGGGG + Intronic
961558723 3:127714284-127714306 AAGCGCAAACAGGAGATGTGGGG + Intronic
962681043 3:137800722-137800744 AAGAGCAAGCAGAAGGTATTGGG + Intergenic
962834356 3:139173747-139173769 CAAAGAAACCAGAAGTTCTGGGG - Intronic
965140300 3:164824814-164824836 AAAAGCAACTAGAAGTACTGTGG + Intergenic
965360644 3:167734893-167734915 AAGAGGAACCAGGCGTTGTCCGG + Intronic
965448770 3:168810238-168810260 AAGAGGAATGAGAAGTTGTGAGG + Intergenic
967650482 3:191979475-191979497 AACAGCAACCACAAACTGTGAGG + Intergenic
969648952 4:8451924-8451946 AAGAGCAAACATAAATTGTTCGG - Intronic
969876485 4:10139400-10139422 AAGAGCACTCAAAAGTTTTGAGG - Intergenic
970344644 4:15141794-15141816 AAGAGGAAACTGAAGTTCTGGGG + Intergenic
973600456 4:52537667-52537689 TAGAGTAAGCAGAAGTTGTGAGG + Intergenic
974318766 4:60316311-60316333 AAGAGCATCCAGAACCTGTGAGG + Intergenic
975282561 4:72578588-72578610 AAGAGAACACAGAACTTGTGTGG - Intergenic
976416125 4:84777656-84777678 CAGAGCTTACAGAAGTTGTGAGG + Intronic
976902080 4:90191057-90191079 AAGAGAAACAAGAAGTTATAAGG - Intronic
977784283 4:101015100-101015122 AAAAGCTACCACAAGATGTGTGG - Intergenic
977882203 4:102217816-102217838 AAGAACAGCCAGAAAGTGTGGGG - Intergenic
978106148 4:104904267-104904289 AGGAGCCACCAGAGGGTGTGTGG + Intergenic
979417085 4:120455216-120455238 AAGAGCTAGAAGAAGTTGGGTGG - Intergenic
979839291 4:125417894-125417916 TACAGAAAACAGAAGTTGTGAGG + Intronic
984609549 4:181822162-181822184 GAGAGCAGCCAGAAGTGGGGGGG - Intergenic
984634858 4:182099844-182099866 ATGAGCAAACAGAAGTTATGAGG + Intergenic
984985270 4:185322674-185322696 GAGAACAACCAGAAGTTATGTGG - Intronic
985670545 5:1204453-1204475 AACAGCAACCAAAAGCCGTGAGG + Intronic
986329135 5:6704696-6704718 AAGAGCAGCCTGAGGGTGTGGGG - Intergenic
992112917 5:73513000-73513022 AAAAGCAAGCAGTATTTGTGTGG - Intergenic
993821674 5:92625633-92625655 AAGATAAACAAAAAGTTGTGTGG - Intergenic
993839771 5:92863758-92863780 AAATTCTACCAGAAGTTGTGCGG + Intergenic
994477771 5:100291714-100291736 AAGAGAACACAGTAGTTGTGAGG - Intergenic
996244660 5:121247072-121247094 AAGAATCACCAGTAGTTGTGTGG + Intergenic
996533435 5:124550497-124550519 AAGAGAAAACAGGAGTTCTGGGG + Intergenic
996947456 5:129087828-129087850 ATGAGGAAGCAGAAGCTGTGTGG + Intergenic
998560468 5:143166555-143166577 AAAAGGAAGCAGAAGCTGTGAGG - Intronic
999866013 5:155701306-155701328 AAGAGGAAACAGAGGTTCTGGGG - Intergenic
1003965918 6:11251974-11251996 AAGTGCAAGCAGAAGGTGAGGGG - Intronic
1004105732 6:12666027-12666049 AAGAGCAAGCACAAGTGATGGGG + Intergenic
1004227326 6:13798057-13798079 AAGTGCAGTGAGAAGTTGTGAGG - Intronic
1006229387 6:32570095-32570117 AAGAGCCAGCAGAAGAAGTGAGG - Intronic
1013463660 6:110399429-110399451 AGGAGCAAACAGAGATTGTGTGG + Intronic
1014350155 6:120331875-120331897 AAGAAGAAACAAAAGTTGTGTGG + Intergenic
1014512896 6:122346276-122346298 ATGTGCAACAAGAAGTTGTTTGG + Intergenic
1015049353 6:128820121-128820143 AAGAGCAGACAGAAATTGAGGGG + Intergenic
1019232305 6:170577896-170577918 AAGACCAAACAGAAGGTGAGAGG - Intronic
1019756977 7:2777910-2777932 AAGATCAACTAAAACTTGTGAGG + Intronic
1020221911 7:6245379-6245401 AGGAGGAGCCAGAATTTGTGGGG - Intronic
1028021500 7:85780859-85780881 ATGAGAAAACAGAATTTGTGGGG - Intergenic
1028141424 7:87279538-87279560 AAGAGCAAACAGAGGTGCTGGGG - Intergenic
1030806193 7:113922486-113922508 AGGAGCAAACAGAAGATATGAGG + Intronic
1031862025 7:126991162-126991184 TATGGCAACAAGAAGTTGTGAGG - Intronic
1032285909 7:130538363-130538385 AAGAACATCATGAAGTTGTGGGG + Intronic
1034104844 7:148481610-148481632 CAGCCCATCCAGAAGTTGTGGGG - Intergenic
1035936618 8:3848195-3848217 AGGAACAATCAGAAGTTGTCAGG + Intronic
1036641071 8:10584199-10584221 ATGGGCAACCAGAAGTCCTGGGG + Intergenic
1037504351 8:19515475-19515497 AAGACCAACGAGGAGTTGAGGGG - Intronic
1037846949 8:22291930-22291952 CAGGGCAATCAGAAGTAGTGGGG + Intronic
1038540743 8:28387793-28387815 AAGAGGAACAAAACGTTGTGGGG + Intronic
1039491794 8:37953253-37953275 AAGAGAAACCAGAGACTGTGTGG + Intergenic
1041041059 8:53846225-53846247 CAAAGCAATCAGAAGTTGTTAGG - Intergenic
1041328029 8:56689831-56689853 AAGAGGTAGCAGAAGTTGTATGG - Intergenic
1042426002 8:68649666-68649688 AACAGCTACCAGAAGGAGTGAGG - Intronic
1043282887 8:78490297-78490319 ACGAACAACCATCAGTTGTGTGG + Intergenic
1044630492 8:94273763-94273785 ATGAGAAAGTAGAAGTTGTGTGG - Intergenic
1046165068 8:110422489-110422511 AAGAGGAACCAGAATGTTTGTGG - Intergenic
1047180230 8:122580634-122580656 AGGATCAGCCAGAAGTTATGAGG - Intergenic
1047206801 8:122809056-122809078 AAGAGAGACCAGAAGCTGTGAGG + Intronic
1047722355 8:127652961-127652983 AAGAGCATCCAGCAGCAGTGTGG - Intergenic
1048480774 8:134790599-134790621 AGGAGAAAACAGAAGGTGTGAGG - Intergenic
1048804630 8:138228658-138228680 AAGAGCAACCAGAAGTTGTGGGG - Intronic
1050894431 9:10869085-10869107 AACAGAAAGCAGAGGTTGTGAGG + Intergenic
1057546910 9:96025998-96026020 AAGAGCAAAGAGAAGTCATGAGG + Intergenic
1058181608 9:101806936-101806958 AAGTGGTACCAGAAGTAGTGTGG + Intergenic
1058185836 9:101853550-101853572 AAAACCAACTAGAAGTTGTTTGG - Intergenic
1058553456 9:106140268-106140290 AAGAGCACCCAGAAACAGTGAGG + Intergenic
1058910156 9:109513458-109513480 AAGTGCAACCAGGTGTTCTGGGG - Intergenic
1059735394 9:117094930-117094952 AGGAGCACACAGAAGTTATGGGG + Intronic
1061412293 9:130428210-130428232 AAGAGCTAGCAGAAGGGGTGGGG + Intronic
1186084496 X:5972367-5972389 AGGAGTAACCAGAAGCTTTGGGG - Intronic
1188981160 X:36728445-36728467 TAGAGGAACCAGAAGCAGTGTGG - Intergenic
1192062578 X:67843355-67843377 AAGAGCCACCAGAAGGTATTGGG - Intergenic
1192676087 X:73198614-73198636 GAGAGAATCCAGAATTTGTGAGG + Intergenic
1193361770 X:80587174-80587196 AAGGGCAAGCAGAAGTAGGGTGG - Intergenic
1194657892 X:96595761-96595783 CAGTGCAACTAGAATTTGTGAGG - Intergenic
1195794133 X:108625031-108625053 AAGAGAATGCAGAAGATGTGAGG - Intronic
1196319728 X:114272244-114272266 AAGAACAACCAGACCTTATGGGG - Intergenic
1198722550 X:139638464-139638486 AGGAGCAACAGGAAGTGGTGGGG + Intronic