ID: 1048808786

View in Genome Browser
Species Human (GRCh38)
Location 8:138265917-138265939
Sequence GGCCATTAGCCTACTTGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048808786 Original CRISPR GGCCATTAGCCTACTTGAGC AGG (reversed) Intronic
906829991 1:49020892-49020914 TGCCATTAGTCTAGTTGAGGAGG - Intronic
916327797 1:163582527-163582549 GGTGATCAGCCTGCTTGAGCAGG + Intergenic
1066797818 10:39143670-39143692 CGCCATTAGCCTCAATGAGCTGG - Intergenic
1069111986 10:64459211-64459233 GGCCATTAGTCTATTTTAGCTGG + Intergenic
1074464084 10:113666657-113666679 GGGCCTTTGCCTACTTGAGCAGG - Intergenic
1080649477 11:34210690-34210712 GGCCATGAGCTTCCCTGAGCCGG - Intronic
1080948247 11:36998917-36998939 GGCCCTTAGGCTATTTGGGCAGG + Intergenic
1081245546 11:40762167-40762189 CGTCATTAGCCTACATCAGCAGG - Intronic
1081810886 11:45913622-45913644 GGCCATCAGGCCACTTGAGCAGG - Intronic
1083946362 11:65925236-65925258 GGCCCATAGCCTAATTGAGTGGG - Intergenic
1087524442 11:99292024-99292046 GTCCATTTGCTTACATGAGCAGG + Intronic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1106238534 13:27887658-27887680 GGCCATTAGCCTAAGTAAACTGG + Intergenic
1114415022 14:22537030-22537052 GGCAGTTAGCATCCTTGAGCGGG + Intergenic
1123665263 15:22603781-22603803 GACCATTTGCCACCTTGAGCAGG - Intergenic
1124401160 15:29348701-29348723 GGCCATTTTCCTACTGGGGCTGG - Intronic
1139415053 16:66801386-66801408 GGCCCTTAGCCCACGTGAGAAGG - Intronic
1141092010 16:81136887-81136909 GGCCAGTGGCCTCCTAGAGCAGG + Intergenic
1144178695 17:12732295-12732317 GGCCATTAGCATGCTTGGGTTGG - Intronic
1145787867 17:27605661-27605683 GGCCATTCGCCTGCTGGAGATGG + Exonic
1147674422 17:42194700-42194722 CGCCATTAAGCCACTTGAGCTGG + Intergenic
1147818022 17:43224212-43224234 GGTCACCAGCCTACTTCAGCGGG - Intergenic
1152718025 17:81909165-81909187 GGCCCTTAGCCCACTAGTGCTGG + Intronic
1154987189 18:21563865-21563887 GGGCATTAACCTATTTGTGCGGG - Intronic
1157480136 18:48048519-48048541 GGTAATTACCCTCCTTGAGCTGG + Intronic
1161350889 19:3790915-3790937 GCCCATTAGCCTGCCTGAGAAGG + Intronic
1165105657 19:33468453-33468475 GGCCAAGAGCCCACCTGAGCTGG + Intronic
1167092273 19:47352835-47352857 GGCCAGAGGCCTGCTTGAGCTGG - Exonic
932629987 2:73332653-73332675 GGCCATTATCATACTTGTTCTGG - Intergenic
933744583 2:85561372-85561394 GGTCCTAAGCCTACCTGAGCTGG + Exonic
939562298 2:143746928-143746950 GGCCATAAGGATACATGAGCAGG + Intronic
948338269 2:237228431-237228453 AGCCATTAGCCCACTAGGGCTGG - Intergenic
1170732295 20:18985685-18985707 GGCTATGAGCGCACTTGAGCAGG + Intergenic
1172174881 20:32966251-32966273 GCCCATCAGCTCACTTGAGCTGG + Intergenic
1172833329 20:37855604-37855626 GGGCATCAGCCTACGTGAGAAGG - Intronic
1178410355 21:32358706-32358728 TCCCATGAGCCTAGTTGAGCTGG + Intronic
952729709 3:36626037-36626059 GGACACTAGCCTGCTTCAGCTGG + Intergenic
956895254 3:73653233-73653255 TGCCTTTGGCCTACTTGAGAGGG - Intergenic
961569122 3:127785621-127785643 GGCCATCAGGCGACTTGCGCAGG - Intronic
966334956 3:178857519-178857541 GGCCATTATCCTGCCTGAACTGG - Intergenic
968837473 4:2975602-2975624 GGACATTTTCCTCCTTGAGCCGG + Intronic
971279443 4:25230399-25230421 GGCCATTAGACAGCATGAGCAGG - Intronic
979993309 4:127401785-127401807 GAACATTAAACTACTTGAGCTGG + Intergenic
986210633 5:5668038-5668060 GGCCAGTAGCCTCCTGGAGGAGG - Intergenic
987850327 5:23344416-23344438 GGCCATTATCCTAAGTGAACTGG + Intergenic
1012766879 6:103377994-103378016 TTCCATTAGCATACCTGAGCTGG - Intergenic
1017519382 6:155187996-155188018 GGCCATTAGTCTACAAGAGGTGG + Intronic
1020357341 7:7292014-7292036 GCCCATTAGCCTTCCTGAGGGGG + Intergenic
1035529074 8:337059-337081 GCCAATTAGCCAACGTGAGCAGG - Intergenic
1048808786 8:138265917-138265939 GGCCATTAGCCTACTTGAGCAGG - Intronic
1056192284 9:84196095-84196117 AGCCAATAGCATACCTGAGCAGG + Intergenic