ID: 1048818256

View in Genome Browser
Species Human (GRCh38)
Location 8:138354480-138354502
Sequence CACCCAGGAGGTATCAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048818256 Original CRISPR CACCCAGGAGGTATCAGGAT GGG (reversed) Intronic
901533798 1:9869884-9869906 CACCCAAGAGATCCCAGGATGGG + Intronic
901777998 1:11573873-11573895 CACACAGCAGGGCTCAGGATGGG - Intergenic
902391484 1:16109638-16109660 CACCCAGGGGGCATGAGGAAGGG + Intergenic
902554275 1:17237848-17237870 CAGCCTGCAGGTGTCAGGATAGG + Intronic
903058721 1:20654677-20654699 CACCAAAGGGTTATCAGGATCGG + Exonic
906175612 1:43769438-43769460 AACCGAGGAAGTAGCAGGATGGG + Intronic
916479482 1:165202196-165202218 CATCCAGGAGGGGCCAGGATAGG - Exonic
920095612 1:203484579-203484601 GACCCAGGACATTTCAGGATAGG - Intronic
923651938 1:235882359-235882381 CACACAGGAGCTTTCAAGATCGG - Intronic
1063067257 10:2622900-2622922 AACCCAGGAGTTACCAGGATTGG - Intergenic
1063608345 10:7542181-7542203 CAGCCAGGAGGAATCAGCAAGGG - Intergenic
1064097507 10:12434907-12434929 AGCCCAGGAGGAATCAGGAGGGG + Intronic
1066425467 10:35304019-35304041 CACCCAGCAGGTATCAGGAATGG - Intronic
1068770689 10:60817584-60817606 CACCCAGGAGGTCAGTGGATAGG - Intergenic
1072900433 10:99402296-99402318 CAGCTGGGAGGTAACAGGATTGG - Intronic
1074960489 10:118440674-118440696 CACCCATCAGGCATCAGAATTGG + Intergenic
1076034884 10:127191213-127191235 CTCCCAGGTAGAATCAGGATAGG - Intronic
1076264037 10:129094949-129094971 CTTCCAGGAAGCATCAGGATTGG + Intergenic
1076808491 10:132872843-132872865 CACACAGGAGGTCACAGGAGCGG + Intronic
1078686266 11:13534932-13534954 CACCCAGGAAGTGTAAGGGTTGG - Intergenic
1078716521 11:13844958-13844980 CATCCAGAATGTACCAGGATGGG - Intergenic
1081717837 11:45263453-45263475 CACCCAGGAGGTTGCAGGTGGGG + Intronic
1081766961 11:45618070-45618092 CAGCCAGGAAGTAGCAGGGTCGG + Intergenic
1082665489 11:55971062-55971084 CCCCCAGGAGGTACCTGGCTGGG - Intergenic
1083569429 11:63749645-63749667 CACCGATTAGGTTTCAGGATAGG - Intronic
1089297412 11:117478364-117478386 CACCCAGGAGTAAACAGGAAGGG - Intronic
1089654997 11:119940891-119940913 CAGCCAGGAGGGCCCAGGATTGG + Intergenic
1096480126 12:51934554-51934576 CACCCAGGAGATGTCTGGAGAGG - Intergenic
1101700809 12:107172015-107172037 AACTCAGGAGGGATCAGAATTGG + Intergenic
1102412308 12:112730582-112730604 AACCAAGGAGGAAGCAGGATTGG - Intronic
1102510319 12:113410726-113410748 CACCAAGAATGTATCAGGCTGGG + Intronic
1102525341 12:113508748-113508770 TCCCCAGGAGGTGCCAGGATTGG + Intergenic
1103448442 12:121010367-121010389 AACCCAGGAGGGAACAGAATTGG - Intronic
1104707069 12:130955446-130955468 CAACCAGGAAGCATCAGGACGGG + Intronic
1104968495 12:132520610-132520632 CCCCCAGGAGGTAGCAGCAGGGG + Intronic
1105440467 13:20411146-20411168 CACCCAGAATATATCAAGATTGG - Intronic
1106529611 13:30577398-30577420 CCTCCAGGTGCTATCAGGATTGG - Intronic
1106838172 13:33658749-33658771 CTCCCAGGTAGTTTCAGGATGGG + Intergenic
1106841331 13:33687818-33687840 CACCAAGGAGGGTGCAGGATGGG + Intergenic
1109115573 13:58378525-58378547 CACCAATGAGGTATAAGGAAAGG - Intergenic
1109214968 13:59579369-59579391 CTCCCAGGAGGTTGCAGGGTGGG + Intergenic
1111616956 13:90671902-90671924 CACCGAAGAGGTATCACAATGGG - Intergenic
1118002120 14:61533050-61533072 CAGCCAGAAGGTAACAGGACTGG - Intronic
1119548732 14:75492840-75492862 CAGCCAGGAGGTGCCAGGCTGGG - Intergenic
1120824482 14:88942964-88942986 AACCCACGAGGTATCAGGGGTGG + Intergenic
1121458685 14:94056294-94056316 CCCCCAGGTAGTTTCAGGATGGG + Intronic
1127482570 15:59390962-59390984 CTCCCAGAAGGTAGCAGGGTAGG + Intronic
1132517924 16:374493-374515 CACCCAGGAGCAAGCAGGGTAGG + Intronic
1132767093 16:1539914-1539936 CACCCTGGAGGTCTCAGGGCTGG + Intronic
1133323620 16:4930333-4930355 CACGCAGGAGGTGACTGGATGGG + Intronic
1135189837 16:20345781-20345803 CAGCCAGTAGGCATCAGCATTGG - Intronic
1135906335 16:26515319-26515341 CACTAAGGAGGTATCAGAAGAGG + Intergenic
1136022669 16:27449899-27449921 CAGCCAGAAGGTATCAGAGTCGG - Exonic
1137270137 16:46897837-46897859 CAGCCAGAGGGTATCAGGCTGGG - Intronic
1137764460 16:50967362-50967384 CACCCAGTAGGTCTGTGGATGGG + Intergenic
1139330505 16:66185740-66185762 GAAACAGGAGGTATAAGGATTGG - Intergenic
1139421794 16:66853632-66853654 CACCCTGGAGGCTTCTGGATGGG + Exonic
1139702243 16:68715114-68715136 CACCCAGGAAGTAGCAGAAAGGG + Intronic
1142108624 16:88319382-88319404 CACACAGGAGGTGCAAGGATTGG + Intergenic
1145278325 17:21450097-21450119 CTCCCAGCAGGTGGCAGGATGGG - Intergenic
1145316148 17:21735993-21736015 CTCCCAGCAGGTGGCAGGATGGG - Intergenic
1145401128 17:22533939-22533961 CTCCCAGCAGGTGGCAGGATGGG + Intergenic
1145714578 17:27007918-27007940 CTCCCAGCAGGTGGCAGGATGGG - Intergenic
1147600250 17:41740740-41740762 CAGCCAGGAAGTATCAGGGAGGG + Intergenic
1148086264 17:44995559-44995581 CAGCCAGGAGGGGTCAGGAGGGG - Intergenic
1148256796 17:46141255-46141277 AACCCAGTAGGTCTCAGGACAGG + Intronic
1150452402 17:65279708-65279730 AGCCCAGGAGGTATCAAGGTGGG - Intergenic
1151713493 17:75819764-75819786 CACCCAGGAAGCATCACCATCGG + Exonic
1152582154 17:81170901-81170923 CACCCAGGAGGTAACAGAGCTGG + Intergenic
1157310062 18:46546114-46546136 CAGCCAGGAGGAGTCAGAATGGG - Intronic
1158395113 18:57073206-57073228 CATCCAGGAGGTAAGAGGACAGG - Intergenic
1159103497 18:63980588-63980610 CACCCAGCAGCTACCAGGACAGG - Intronic
1160923153 19:1529890-1529912 TACCCAGGAGGGCCCAGGATGGG - Intronic
1161692999 19:5748140-5748162 GACCTAGGAGGTAACAGGACAGG - Exonic
1162080674 19:8215852-8215874 CACCCAGACGGTAACAGGACGGG + Intronic
1162386301 19:10362251-10362273 CAACCAGGAGGTACGATGATAGG - Exonic
1163650535 19:18515328-18515350 CTGCCAGGAGGCATCAGGAGTGG - Intronic
1164565651 19:29324106-29324128 CACCCAGCCGGTAAAAGGATTGG + Intergenic
1165755940 19:38293032-38293054 CCCACAGGAGGCAGCAGGATTGG - Intronic
1167234199 19:48303827-48303849 CACCCAGGAGGTCTCTGTGTTGG - Intronic
1167748240 19:51365424-51365446 CACCCTGGAGGCCTCAGGGTGGG - Intronic
930630819 2:53753059-53753081 CAACCAGGAGGTAAAAGGAAGGG + Intronic
932340691 2:70961132-70961154 CAGCCAGGAGGGGTGAGGATGGG + Intronic
932620172 2:73260473-73260495 CACCCAGGAGGTGGCAGCAGAGG - Exonic
936938358 2:117859275-117859297 CCCGCAGGAGGGATCAGGATAGG + Intergenic
938740357 2:134225634-134225656 CTTCCATGAGGTCTCAGGATGGG + Intronic
942329926 2:174812237-174812259 TACCCAAAAGGCATCAGGATTGG + Intronic
945191670 2:207195142-207195164 GGTCCTGGAGGTATCAGGATTGG - Intergenic
947491756 2:230601865-230601887 CACCCAGGACGAATGAGGTTTGG + Intergenic
947918885 2:233853088-233853110 CACCCAAGATGTGTCTGGATTGG + Intronic
948270791 2:236671841-236671863 CACCCAGGAGCTATGCGCATGGG - Intergenic
948425623 2:237885286-237885308 CCCCCACGAGGTCTCGGGATGGG + Intronic
948674330 2:239588213-239588235 CTCCCACGTGGCATCAGGATGGG + Intergenic
1168997200 20:2142325-2142347 CTCCCAAGAGGCAGCAGGATAGG - Intronic
1170141311 20:13127664-13127686 GCCCCAGGGGGTATCAGTATGGG - Intronic
1171977468 20:31604699-31604721 CACCCGGGAGGGATCTGGGTAGG + Intergenic
1174224641 20:48987091-48987113 TCCCCAGGAGGTGGCAGGATTGG + Intronic
1174256117 20:49256651-49256673 CTCCCAGGAGGCATCAGGAAAGG - Intronic
1176055061 20:63140992-63141014 CACCCAGGATGCACCAGGCTGGG + Intergenic
1179284996 21:39969689-39969711 CCCCCAGGATGTATCAGCATGGG - Intergenic
1179589766 21:42398824-42398846 CTCCCAGGAGACATCAGGATAGG - Intergenic
1182028291 22:27137599-27137621 CACACAGCAGGTCTCAGAATTGG - Intergenic
1183190908 22:36321630-36321652 CACAGAGAAGGTGTCAGGATGGG + Intronic
1183760095 22:39808300-39808322 AACAAATGAGGTATCAGGATAGG - Intronic
1184887296 22:47354171-47354193 CACACAGGGTGTTTCAGGATGGG + Intergenic
1185379734 22:50502908-50502930 TTCCCAGGAGGCATGAGGATGGG - Intergenic
951670039 3:25170921-25170943 CAGACAGGAGGTAGCATGATTGG - Intergenic
952520270 3:34149978-34150000 CATCCAGGAGAGACCAGGATGGG - Intergenic
955820337 3:62889768-62889790 CAAGCAGGTGGTATCATGATAGG - Intergenic
962747583 3:138408764-138408786 CACCCAGGAGCTTTCTGGAAAGG + Intergenic
965692410 3:171371668-171371690 CACCTGGGAGGCCTCAGGATCGG + Intronic
968553495 4:1236183-1236205 CCCCCAGGAGCTCACAGGATAGG - Intronic
969722013 4:8897333-8897355 CTCCCAGGGGGTCTCAGGCTTGG + Intergenic
976672122 4:87665519-87665541 CACCCAGGAGGTCTGAGCATGGG - Intergenic
980282319 4:130737418-130737440 CACCCAGGAAGAATGAGGTTAGG - Intergenic
981630729 4:146815506-146815528 GTCCCAGGAGAAATCAGGATTGG + Intronic
984019575 4:174468625-174468647 CACCCAGGCGGCATTAGGTTGGG + Intergenic
985771982 5:1817542-1817564 CATCCAGGAGGTCTCTGGGTTGG + Intergenic
987336736 5:16904024-16904046 CCCCTAGGTGGTTTCAGGATGGG + Intronic
989495469 5:42107113-42107135 CTCCCAGCAGGTATCTGCATGGG + Intergenic
993804360 5:92386067-92386089 CTCCCATCAGGAATCAGGATTGG + Intergenic
994790230 5:104215972-104215994 CAATCAGGAGGTATAAGGAAAGG + Intergenic
995645668 5:114308274-114308296 AAAACAGCAGGTATCAGGATTGG - Intergenic
998544647 5:143016381-143016403 CACACAGGAGGTAAAAAGATGGG + Intronic
999480246 5:151941440-151941462 CACTGAGCAGGTATGAGGATGGG + Intergenic
999862616 5:155664763-155664785 CTTCCAAGAGGTATCAGGAAGGG + Intergenic
1000547983 5:162625589-162625611 CACCCAGGAAGTATGAGGAGTGG + Intergenic
1006034336 6:31199864-31199886 CACCCAGGAGAGATCTGGGTGGG + Intronic
1006413283 6:33888180-33888202 GACCCAGGATGCATCAGAATGGG + Intergenic
1007374244 6:41445495-41445517 CTGCCATGAGGTATCAGGCTGGG + Intergenic
1010379229 6:75206781-75206803 AACCCAGGAGTTCTCAGAATAGG + Intergenic
1011827207 6:91322869-91322891 CACCCAGTTGGTGTCAGCATTGG - Intergenic
1015812516 6:137175120-137175142 CACCCAGGAGGGAGCACCATGGG - Intergenic
1016870612 6:148812802-148812824 CTCCCATGCTGTATCAGGATTGG - Intronic
1018159544 6:161025040-161025062 CACCCAGTAGTTATCAATATGGG + Intronic
1018469522 6:164083302-164083324 CCCCCACAAGGTATCAGAATAGG - Intergenic
1021154015 7:17186915-17186937 TGGCCAGGAGATATCAGGATGGG - Intergenic
1023381685 7:39614425-39614447 CAGCCATGAGGTATGAGGATTGG + Intergenic
1024615530 7:51108618-51108640 AACCCAGGAGGCCACAGGATGGG - Intronic
1026634702 7:72071211-72071233 CAGCCAGCAGGAATCAGGTTGGG + Intronic
1027201505 7:76066830-76066852 CCCCCAGGAGGAATCAGGCCTGG - Exonic
1030476494 7:110040285-110040307 CATAAAGGAGGTATTAGGATTGG - Intergenic
1032465892 7:132144778-132144800 CACCCAGGAGGTACTTGGATGGG + Intronic
1034051747 7:147990984-147991006 CCCCTAGGTGGTTTCAGGATGGG - Intronic
1035752155 8:2003273-2003295 GACCCAGGAGGTGTGCGGATGGG + Exonic
1036918116 8:12824644-12824666 CTCCCAGACGATATCAGGATTGG + Intergenic
1039408346 8:37331473-37331495 CCCCCGGGAGGGATCAGGACAGG + Intergenic
1041423492 8:57695038-57695060 CACCCAGGAAGCATAAGGGTCGG + Intergenic
1041714163 8:60918974-60918996 CACCCAGCACATCTCAGGATGGG + Intergenic
1043950018 8:86298619-86298641 TAGCAAGGAGGTATCAGGAGAGG - Intronic
1046639787 8:116716399-116716421 CACCTAGGAAGTATCAGAATAGG - Intronic
1046655593 8:116890872-116890894 CACCTAGGTAGTTTCAGGATGGG + Intergenic
1048818256 8:138354480-138354502 CACCCAGGAGGTATCAGGATGGG - Intronic
1056790533 9:89622563-89622585 CACCCTGGAAGTTTCAGGAGAGG + Intergenic
1058710492 9:107674892-107674914 CACTGAGGATGTTTCAGGATAGG + Intergenic
1060113036 9:120920023-120920045 CACACAGGATGTCACAGGATCGG + Intronic
1061390313 9:130314134-130314156 CAACCAGGAGCTTCCAGGATGGG - Intronic
1061911655 9:133728289-133728311 CACCGGGGAGGTACCAGGCTTGG - Intronic
1062374555 9:136256052-136256074 GACCCAGGAGGGCTCAGGGTGGG + Intergenic
1188958300 X:36460788-36460810 AATGCAGGAGGGATCAGGATTGG + Intergenic
1198777969 X:140201231-140201253 CAGCCAGGATGTGTCAGAATGGG + Intergenic
1199717280 X:150515662-150515684 CTGCCAGGAGGAATGAGGATAGG - Intergenic
1201982076 Y:19918788-19918810 CAGCCAGGAGGTTCCAGGAAAGG - Intergenic