ID: 1048820738 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:138378396-138378418 |
| Sequence | ACTTGCAGTTGGGGAAACTG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3283 | |||
| Summary | {0: 2, 1: 2, 2: 52, 3: 475, 4: 2752} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1048820738_1048820743 | -8 | Left | 1048820738 | 8:138378396-138378418 | CCTCAGTTTCCCCAACTGCAAGT | 0: 2 1: 2 2: 52 3: 475 4: 2752 |
||
| Right | 1048820743 | 8:138378411-138378433 | CTGCAAGTTGCTTTGGAGTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1048820738 | Original CRISPR | ACTTGCAGTTGGGGAAACTG AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||