ID: 1048820738

View in Genome Browser
Species Human (GRCh38)
Location 8:138378396-138378418
Sequence ACTTGCAGTTGGGGAAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3283
Summary {0: 2, 1: 2, 2: 52, 3: 475, 4: 2752}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048820738_1048820743 -8 Left 1048820738 8:138378396-138378418 CCTCAGTTTCCCCAACTGCAAGT 0: 2
1: 2
2: 52
3: 475
4: 2752
Right 1048820743 8:138378411-138378433 CTGCAAGTTGCTTTGGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048820738 Original CRISPR ACTTGCAGTTGGGGAAACTG AGG (reversed) Intronic
Too many off-targets to display for this crispr