ID: 1048820743

View in Genome Browser
Species Human (GRCh38)
Location 8:138378411-138378433
Sequence CTGCAAGTTGCTTTGGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048820738_1048820743 -8 Left 1048820738 8:138378396-138378418 CCTCAGTTTCCCCAACTGCAAGT 0: 2
1: 2
2: 52
3: 475
4: 2752
Right 1048820743 8:138378411-138378433 CTGCAAGTTGCTTTGGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048820743 Original CRISPR CTGCAAGTTGCTTTGGAGTC TGG Intronic
No off target data available for this crispr