ID: 1048823018

View in Genome Browser
Species Human (GRCh38)
Location 8:138397029-138397051
Sequence GAGCCAGGTGTGCATCCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048823016_1048823018 -4 Left 1048823016 8:138397010-138397032 CCACAGCTAGCAATGATGGGAGC 0: 1
1: 0
2: 2
3: 9
4: 111
Right 1048823018 8:138397029-138397051 GAGCCAGGTGTGCATCCCTCAGG No data
1048823012_1048823018 17 Left 1048823012 8:138396989-138397011 CCTTGACTAATTTGTCCAACACC 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1048823018 8:138397029-138397051 GAGCCAGGTGTGCATCCCTCAGG No data
1048823013_1048823018 2 Left 1048823013 8:138397004-138397026 CCAACACCACAGCTAGCAATGAT 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1048823018 8:138397029-138397051 GAGCCAGGTGTGCATCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048823018 Original CRISPR GAGCCAGGTGTGCATCCCTC AGG Intronic
No off target data available for this crispr