ID: 1048823529

View in Genome Browser
Species Human (GRCh38)
Location 8:138400930-138400952
Sequence AGAGATCTTAAAATGGTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048823529_1048823531 -7 Left 1048823529 8:138400930-138400952 CCATCAACCATTTTAAGATCTCT 0: 1
1: 0
2: 4
3: 25
4: 230
Right 1048823531 8:138400946-138400968 GATCTCTGATAAGATTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048823529 Original CRISPR AGAGATCTTAAAATGGTTGA TGG (reversed) Intronic
903523872 1:23977488-23977510 ATAGATTTTAAAGTGGTTGCTGG - Intronic
905124372 1:35707099-35707121 AGAGATCTTAAACTGGAGGAGGG + Intergenic
907036215 1:51218676-51218698 AGAAATAATAAAATGGTTGTTGG - Intergenic
908192805 1:61720787-61720809 TGTGATCTTAAAATGGTTCTTGG - Intronic
909267863 1:73584766-73584788 AGAGATCTAAAATAGGGTGATGG + Intergenic
909409812 1:75336967-75336989 TGGCATCTGAAAATGGTTGAGGG + Intronic
909756387 1:79231150-79231172 AGGGATTTTAAAATGGGAGAGGG - Intergenic
909981775 1:82111162-82111184 AGGGATCAGAAAATGGTTCAAGG + Intergenic
912123045 1:106497165-106497187 AGAGATCTTTATATCATTGATGG - Intergenic
912227872 1:107756161-107756183 AGACATTTTAAAATAGGTGAAGG - Intronic
912536894 1:110380778-110380800 AGAGATCTTGAAATACTTGCAGG - Intronic
912819765 1:112857483-112857505 AGAGTCCTTAAAATGGAAGAAGG + Intergenic
913303741 1:117400944-117400966 AGAGTTCTGGAAATGGATGATGG - Intronic
914331551 1:146675468-146675490 AGACATTTTAAAATGGATCAAGG - Intergenic
915452604 1:156016899-156016921 AGGGAACTTATAATGGTAGAAGG - Intronic
916286677 1:163113186-163113208 AGAGATCTTGACAGTGTTGAGGG - Intronic
916842091 1:168610948-168610970 AGAGAGCTTAAAATAGTGGCTGG + Intergenic
918275365 1:182949126-182949148 AGAGATCTTGAAAAGTTTTATGG + Intronic
918411345 1:184261088-184261110 AGAGATCTCAAATTGGAAGAGGG + Intergenic
918587421 1:186203892-186203914 AGATAGCTAAGAATGGTTGAAGG - Intergenic
918685729 1:187412598-187412620 AAAGATGTTAAAATGGAAGAGGG + Intergenic
918756834 1:188348698-188348720 AGAAATCTGAAAATGATTGGTGG - Intergenic
918846068 1:189615341-189615363 AGAAGTGTTAAAATGGTTGAGGG + Intergenic
919459520 1:197859707-197859729 AGAGATTTTAAAATGTTAGAGGG - Intergenic
919475675 1:198030769-198030791 AGGGATCTCATAATGTTTGATGG - Intergenic
920896473 1:210055893-210055915 AGAGATTTCTAAATGGTTAAAGG - Intronic
921660423 1:217794432-217794454 AGGGACCTTAAAATCATTGACGG + Intronic
922887265 1:229029589-229029611 AGACAGCTGAAAATGATTGAGGG - Intergenic
923282725 1:232460350-232460372 AGAGATGTTGAACTGGTTCAGGG - Intronic
923294082 1:232576065-232576087 AGAGGTCTGAAAATGGATGATGG + Intergenic
923401258 1:233617374-233617396 AGAGATGTTAAATTGTTTGCTGG - Intronic
1063178677 10:3575643-3575665 AGAGATCAGCAAATGATTGATGG - Intergenic
1063535673 10:6880723-6880745 ACAAATCATAAAAAGGTTGAAGG - Intergenic
1063656143 10:7990997-7991019 GAAGGTCTTAAAAGGGTTGAAGG - Intronic
1065211948 10:23412565-23412587 AATGATCTCAAAATAGTTGATGG - Intergenic
1066214071 10:33268615-33268637 AGAGATCTGAAGACAGTTGAAGG - Intronic
1067895390 10:50174017-50174039 AGAGATCTTCCAATCTTTGAGGG - Intergenic
1068554069 10:58438477-58438499 AGAGCTCATAAAATGCATGATGG + Intergenic
1071213529 10:83371969-83371991 AGAGAATTTAAAGTGGTTGGAGG + Intergenic
1073157337 10:101357998-101358020 AGAGAAATGAAAATGATTGAGGG + Intronic
1073639323 10:105234174-105234196 AGACATATTTAAAGGGTTGAGGG - Intronic
1073798480 10:107014425-107014447 AGAGCTGTTAAAATGTTTCAAGG + Intronic
1073982844 10:109174534-109174556 AGAGATCTTAAGCTGGTATAAGG - Intergenic
1077971674 11:7198974-7198996 AAATACCTTAAAATGGTAGAGGG + Intergenic
1078303965 11:10163748-10163770 AGAGTGCTTAAAATGGTTCCTGG + Intronic
1079887531 11:26005680-26005702 AGAGCTCTTAAGATGGTGGCAGG - Intergenic
1080900779 11:36488493-36488515 AGACAACTTTAAATGGTGGATGG + Exonic
1083349498 11:62017330-62017352 AGAGATCAAGAAATGGGTGAAGG - Intergenic
1085117363 11:73941515-73941537 ATAGATCTTCAGATGTTTGATGG + Intergenic
1086242969 11:84718845-84718867 AGAGATCTTAGAATTGTTGAAGG - Intronic
1086824077 11:91473936-91473958 AGAGGACTTAAAGAGGTTGAAGG + Intergenic
1087562864 11:99813904-99813926 AGAGATCTTATAAAAGTTCAAGG + Intronic
1088437446 11:109831037-109831059 AGAGCTATTAAAATGTTTGGAGG - Intergenic
1090898542 11:131003963-131003985 AAATATGTTAAAATGGTTGTGGG - Intergenic
1093826602 12:23698462-23698484 AGAGATCTGAAAATACTGGATGG - Intronic
1096256769 12:50066916-50066938 AAAGATCTTAAAAAGGCAGAGGG - Intronic
1096793537 12:54060103-54060125 AGGAATCTGAAAATTGTTGATGG - Intergenic
1097391949 12:59026083-59026105 AGAAATCTAAGAGTGGTTGAGGG - Intergenic
1097543629 12:60971798-60971820 AGAGAACTGGAAATGGTTGTGGG - Intergenic
1097626407 12:62006806-62006828 GGAGATATTAAAATGGTTGATGG - Intronic
1098810217 12:75078656-75078678 AGAGATCTTAACTTGCTTAAGGG + Intronic
1101160542 12:101969939-101969961 TTAGTTCTTAAAATGTTTGATGG - Intronic
1102620832 12:114193276-114193298 AGACAGCACAAAATGGTTGAAGG - Intergenic
1105289011 13:19035036-19035058 AGATATTTTAGAATGGTTGGTGG - Intergenic
1105379845 13:19876734-19876756 AAAGTTCTGAAAATGGGTGATGG - Intergenic
1108421625 13:50256261-50256283 AGAGATTTAAACATGGATGAAGG - Intronic
1110011171 13:70335924-70335946 AGAGATCCTCAAATGGATTATGG + Intergenic
1111836957 13:93400084-93400106 GCAGGTCTTAAAGTGGTTGACGG + Intronic
1112478266 13:99751914-99751936 AACGATCTTAAAATGATTCATGG + Intronic
1113331131 13:109328793-109328815 AGAGACCTTAAGATGATTGGTGG - Intergenic
1113703107 13:112402701-112402723 ACAAAACATAAAATGGTTGATGG - Intronic
1114775064 14:25472669-25472691 ACAGATTTTCAACTGGTTGAGGG + Intergenic
1114903416 14:27096011-27096033 AGAGATATTAAATTGGTTAGTGG - Intergenic
1115080065 14:29439761-29439783 ATAAATTTTAAAATGTTTGAGGG - Intergenic
1115312347 14:31992207-31992229 TGAGGTCTTAAAAGGGTAGAGGG + Intergenic
1116205087 14:41855044-41855066 AGTGATCTTAAAAGGTTTCATGG + Intronic
1117471341 14:56049176-56049198 ATATATCTTAAAATAGTAGAAGG + Intergenic
1117633070 14:57713497-57713519 AGAGAGAATAAAATGTTTGATGG - Intronic
1117645151 14:57843801-57843823 AGAGATATTAAAATTGTTTGGGG - Intronic
1120128049 14:80770603-80770625 AAAAATAATAAAATGGTTGAAGG - Intronic
1122827956 14:104380635-104380657 TGAGATGTGAAAATGGCTGACGG + Intergenic
1126458276 15:48888520-48888542 AGAGTTCTAAAGATGGATGATGG + Intronic
1126641045 15:50827391-50827413 AGACGGCTCAAAATGGTTGAGGG - Intergenic
1127311703 15:57757564-57757586 AGAGATCTTTATGTGGTTGAGGG - Intronic
1127746328 15:61979233-61979255 AGGGATCTTCAAAAAGTTGATGG + Intronic
1128918542 15:71590005-71590027 ACAGATCTAGAAATGATTGATGG - Intronic
1131086796 15:89582375-89582397 ATAGATCATAAAATGTTAGAAGG - Intronic
1131429973 15:92379137-92379159 AGAATTCTTAAAATGTTTGGGGG - Intergenic
1134365428 16:13572856-13572878 AGAGATCATAAAATGATAAAAGG + Intergenic
1139398073 16:66656701-66656723 GGAGATCTTAACCTGGTTAAGGG - Intronic
1140002004 16:71035432-71035454 AGACATTTTAAAATGGATCAAGG + Intronic
1147489364 17:40850190-40850212 AGTTATCTTAAAATGGCTGATGG - Intergenic
1149614294 17:57985803-57985825 ATAGCTATTAAAATGTTTGATGG - Intronic
1152017933 17:77764177-77764199 ACAGATCTTAGAATGCTGGAGGG + Intergenic
1152997367 18:420250-420272 TGAGATGATAAAATGTTTGATGG + Intronic
1153499923 18:5738116-5738138 AAAGATTTAAAAATGCTTGATGG - Intergenic
1153792354 18:8590246-8590268 GGAGATCTTAAAATACTTGGAGG + Intergenic
1154024900 18:10697893-10697915 AGAGATCATAAGATGGGTGGTGG + Intronic
1154470711 18:14697585-14697607 AGAAATTTTAGAATGGTTGGTGG + Intergenic
1156145484 18:34171246-34171268 TGAGATCTTAGAGTGGTAGAAGG - Intronic
1156720003 18:40058464-40058486 AGAGATCTTGAAATGCTTTGAGG - Intergenic
1156737301 18:40275880-40275902 AGAGCTCTTTAAATGCATGAAGG - Intergenic
1158425008 18:57331313-57331335 AGACATTTAAAAATGGTTAAGGG + Intergenic
1158795431 18:60840044-60840066 AAAGCTTTTAAAATGGTTAAAGG - Intergenic
1159363643 18:67437549-67437571 AAAGATGTGAAAATGGTTGATGG + Intergenic
1159502856 18:69296221-69296243 AGAGATATTAGAATTGTGGAAGG - Intergenic
1159518394 18:69487751-69487773 AGAGATCTTCAAAATGTGGAGGG - Intronic
1159939542 18:74396262-74396284 AGAGATCTGAAAATGGGCAAAGG - Intergenic
1160626532 18:80211956-80211978 AGAGTTCTGGAAATGGGTGATGG + Intronic
1161367076 19:3886135-3886157 AGAACTCTTAAAATGGTGTAGGG - Intronic
1161921170 19:7267275-7267297 AGAAAGCTTAAAATGTTTTATGG - Intronic
1163376389 19:16934896-16934918 AGAGTTCTTGAAATGGGTGATGG - Intronic
1164880213 19:31726600-31726622 AGAGTTCTTAAATTGGTTTGGGG + Intergenic
1167144655 19:47674518-47674540 AGAGCTCTAACAATTGTTGAAGG - Intronic
1168430422 19:56274907-56274929 AGAGCTCTTCAAATGTTTCAGGG - Intronic
925124086 2:1441430-1441452 AGAGATTCTAAAATGTTTAAAGG - Intronic
926278767 2:11426851-11426873 AGAGATTAAAAAATGGTTGTGGG - Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
927311008 2:21631110-21631132 AGAGACCTTGAAATGGAGGATGG - Intergenic
927643414 2:24860096-24860118 AGGGATCGGAACATGGTTGACGG - Intronic
928504420 2:31935244-31935266 AGAGATCTTTACATGTTTGAAGG + Intronic
928991856 2:37240693-37240715 AGAGCCCTTAAAATGTATGAAGG + Intronic
930342950 2:50140434-50140456 AGGAATCCTAAGATGGTTGAGGG + Intronic
931193084 2:60024395-60024417 AGAGATCTTCGAAAGGTGGAGGG - Intergenic
932036303 2:68250990-68251012 AGAAGACTTAAACTGGTTGACGG - Intronic
933017702 2:77150512-77150534 TGAGATCTTAAAATGAATGAGGG - Intronic
933241735 2:79929336-79929358 AGAGTTCTTTAAATATTTGAAGG - Intronic
934478296 2:94608462-94608484 AGAAATATTAAAATGGTTACAGG + Intergenic
935277659 2:101489431-101489453 AGAGTTCTAAAGATGGATGATGG - Intergenic
935483548 2:103623725-103623747 AGAGATCTTCACATAGATGAGGG - Intergenic
936606485 2:113962260-113962282 AGAGATTTTGAAATGACTGAAGG - Exonic
938185009 2:129223683-129223705 AAAGTTCTTAAAATGGATGGTGG + Intergenic
939854407 2:147340631-147340653 AAAGAACTTAAAATGGTTCTTGG - Intergenic
942129601 2:172865227-172865249 AGAAATCTTCAAATGGGTGTTGG - Intronic
944183413 2:196922077-196922099 ATTGATCTTAATATGGTAGAGGG - Intronic
944740977 2:202612329-202612351 AGAGTTCTGAAGATGGGTGATGG + Intergenic
945841280 2:214890703-214890725 AGAGATGCTCAAATGGCTGAGGG + Intergenic
946703375 2:222434510-222434532 ATAGTATTTAAAATGGTTGAGGG - Intronic
948170124 2:235894729-235894751 AGAGATCTTAAGATGGAAGGAGG - Intronic
948212567 2:236205469-236205491 AGAGAAATTAAAAGGGTGGAAGG - Intronic
948774128 2:240272931-240272953 GGAGATCTTAAGGAGGTTGAAGG - Intergenic
1168759278 20:338003-338025 AGAGTTCTCAAGATGGATGATGG - Intergenic
1171883999 20:30638663-30638685 AGAGAGATTAAACTGGCTGATGG + Intergenic
1176512208 21:7757327-7757349 AGAGAAATTAAAAAGGGTGAGGG + Intronic
1177165132 21:17592771-17592793 AGAGATGTTAAAATTGTGTATGG + Intronic
1177540806 21:22491827-22491849 AGAGTTCTGAAAATGAATGATGG + Intergenic
1177826282 21:26087553-26087575 AGAAATCTGATAATGGTTGATGG + Intronic
1178646320 21:34387851-34387873 AGAGAAATTAAAAAGGGTGAGGG + Intronic
1180389070 22:12208397-12208419 GAACATCTTAAAATGATTGAGGG - Intergenic
1181611859 22:24019955-24019977 AGAGATATAAAAATGGGTAAAGG - Intronic
1184455362 22:44606972-44606994 AGACACCTTAAAATGTTTGCTGG - Intergenic
949141643 3:640921-640943 ATACATCTTGAAATGTTTGAGGG - Intergenic
949542161 3:5041190-5041212 AAAGTTCTTAAAATGGTTCCAGG + Intergenic
949887185 3:8705485-8705507 AGAAATGATGAAATGGTTGAGGG + Intronic
951433116 3:22631075-22631097 AGAGATATTAAAATAGATCATGG - Intergenic
953373819 3:42412020-42412042 AGAGATATTGAGATGATTGAGGG + Intergenic
954516579 3:51183402-51183424 AGCTATCTTGAAATGGTTGGGGG + Intronic
955084410 3:55688702-55688724 AGAGATCTTAAAATGTGTTGGGG - Intronic
957812960 3:85252046-85252068 TGAGATCTTATGATGTTTGATGG - Intronic
958827944 3:99054806-99054828 GGAGATCTGAGAATGTTTGAAGG + Intergenic
959822492 3:110753057-110753079 GGAGATTTTCAAGTGGTTGAAGG - Intergenic
960443499 3:117718616-117718638 AGATATAGTAAAATGGTGGAGGG + Intergenic
962356288 3:134697147-134697169 AGCTATCTTCAAATGTTTGAAGG + Intronic
962772839 3:138629233-138629255 AGAGATCTTATAATGAATCAAGG + Intronic
963690351 3:148492509-148492531 AGAAATGTGGAAATGGTTGATGG - Intergenic
964019005 3:151984422-151984444 AGTGATCTTAAAATAGTAAACGG + Intergenic
964045561 3:152321058-152321080 ACAGATCTTAAAATAATTGTTGG - Intronic
965062544 3:163802777-163802799 AGGGATCTTAAAAGGATAGATGG - Intergenic
966706557 3:182922726-182922748 AGAAATCAGAAAATGGTTGCTGG - Intergenic
969381036 4:6798073-6798095 AGAGACATAAAAATGTTTGAAGG + Intronic
970958346 4:21841574-21841596 AGTCATCTTAAAATCTTTGAAGG - Intronic
971496390 4:27270375-27270397 TGTGATCTTAAAATATTTGAGGG - Intergenic
972152709 4:36114363-36114385 AGATATCATTAAATGGTGGATGG - Intronic
973811714 4:54577328-54577350 AGAGATAATAAAAAGTTTGAGGG + Intergenic
973926702 4:55746417-55746439 AGAGAACTTGAAAGGGTTGGGGG - Intergenic
975516765 4:75256706-75256728 GGATTTTTTAAAATGGTTGAAGG - Intergenic
976306938 4:83569450-83569472 AAAGATGTAAAAATGGTAGAAGG + Intronic
976504657 4:85832727-85832749 ATAAATTCTAAAATGGTTGAAGG + Intronic
977941729 4:102867013-102867035 AGTGATGTTTAAAAGGTTGATGG - Intronic
980188927 4:129497685-129497707 TGAGATCTTAAACTGGTTGAGGG + Intergenic
980803012 4:137777034-137777056 AGAGAACTAAAAATGCTTGTTGG - Intergenic
981287435 4:143034951-143034973 CCAGATCTTTAAATGGTAGAGGG + Intergenic
981365693 4:143900111-143900133 ATAGATTTAAAAATGGGTGAAGG + Intronic
981864095 4:149393621-149393643 AGAGATTTTAAAAGGATTAAGGG + Intergenic
982947917 4:161649775-161649797 AGAGATCTATAAATGGTTGTGGG + Intronic
985938613 5:3116000-3116022 AGAGATAATAATATGGTAGATGG - Intergenic
988912086 5:35853475-35853497 TGAGATCCTAAAATGTTAGAGGG - Intronic
988994407 5:36700981-36701003 TGAGATCATTAAATGGCTGAAGG + Intergenic
989389811 5:40888293-40888315 AGAGGTTTTAAGATGGATGAAGG + Intergenic
989761563 5:45022342-45022364 AAAGATGTTTAAATGGTTCATGG - Intergenic
989962097 5:50428678-50428700 AGAGAAGATAAAATGGCTGACGG + Intronic
990774881 5:59295134-59295156 AAAAATCTTCAAATGGTTCATGG - Intronic
992081997 5:73242676-73242698 AGAGAAAATAAAATGGATGAAGG - Intergenic
992353872 5:75958987-75959009 TGAGGTCTTAAAATATTTGAGGG - Intergenic
997050055 5:130369697-130369719 AGAGATGTTAAAAAGGTTTTAGG - Intergenic
999122794 5:149222394-149222416 AGAATTCTTAAACTGGTTCATGG + Intronic
1000029962 5:157393260-157393282 GGAGTTCTTAATATAGTTGAGGG - Intronic
1002382991 5:178843588-178843610 AGGGGTCTTAAGATGGTTGAGGG + Intergenic
1006833651 6:36984328-36984350 ACAGATTTGAAAATTGTTGATGG - Intronic
1007768801 6:44177254-44177276 AGAGATCTTAAACTGGGGGTTGG - Exonic
1008286759 6:49662386-49662408 AAAGTTCTGGAAATGGTTGATGG + Intergenic
1008708234 6:54190223-54190245 AGAGATCTAAAAAGAGTTTAAGG + Intronic
1010227634 6:73505878-73505900 AGAGTTCTGGAGATGGTTGATGG + Intronic
1010371446 6:75114192-75114214 TGAGATCATAAAATGGCTTAAGG + Intronic
1010960585 6:82141370-82141392 AGAGAGCTTGAATTGGTTGCAGG - Intergenic
1011314833 6:86019777-86019799 AGACATCTTAAAATGTTGGATGG + Intergenic
1011873934 6:91932750-91932772 AGAGATCTTCAAAAGATTCAAGG + Intergenic
1012623320 6:101376107-101376129 ACAGATCTTAAAACAGTTTATGG - Intergenic
1013951856 6:115792462-115792484 AGACATCTTAAGATGATTGCAGG - Intergenic
1015084933 6:129279177-129279199 ACAGAATTCAAAATGGTTGATGG + Intronic
1017294071 6:152774192-152774214 AGAGATATTAAAGTGGTGGCCGG + Intergenic
1017296593 6:152803251-152803273 ACAAATCTTAAAATGGATTAAGG - Intergenic
1017548727 6:155481159-155481181 TGAGAACTTAGAAGGGTTGAAGG + Intergenic
1017837915 6:158196467-158196489 AGAGGTCTTCAAAAAGTTGATGG + Exonic
1017842681 6:158233855-158233877 AGAGCTCTTAAAATTCTTAAAGG - Intronic
1018687675 6:166316503-166316525 ATAGATCTTCAGATGGTTGGTGG - Intergenic
1018691264 6:166345977-166345999 ATAGATCTTCAGATGGTTGGTGG + Intergenic
1019114666 6:169750494-169750516 AGTAATCTTAAAATGTTTTAGGG + Intronic
1020717292 7:11690837-11690859 AGAAAACTAAAAATTGTTGAAGG - Intronic
1020914866 7:14180226-14180248 AATGATCTGAAACTGGTTGATGG + Intronic
1021261391 7:18461725-18461747 AGTGATCTTAAAATAATTAAGGG - Intronic
1021316227 7:19150706-19150728 AGAGTTCTTGAGATGGATGATGG - Intergenic
1024188333 7:46977884-46977906 AAAAATCTTAAAATTGTTGAAGG - Intergenic
1026666934 7:72349171-72349193 AAAAATCTTAAAATCTTTGATGG + Intronic
1028116243 7:87001234-87001256 GGTGATATTATAATGGTTGAAGG + Intronic
1028575347 7:92343468-92343490 AGAGAACTTAAAACAGTTTAGGG + Intronic
1028817654 7:95165768-95165790 AGAGATCTTACAGTGATTGCTGG + Intronic
1033856259 7:145564878-145564900 AGAGGTCTTATAAATGTTGAAGG - Intergenic
1037766160 8:21773572-21773594 GGAGATCTTACAATGGTTTATGG + Intronic
1044067041 8:87711341-87711363 AGACATGTTAAAATAGTTGATGG + Intergenic
1044293412 8:90499713-90499735 AGAAATCTTAAATAGGATGATGG - Intergenic
1044392505 8:91668496-91668518 AGAGATCTTGTAAGGGATGAGGG - Intergenic
1045213662 8:100125260-100125282 AGAGATCAGAAAATGATTCATGG + Intronic
1048718114 8:137291054-137291076 AGAGATCTTTAGATGGTAGTTGG - Intergenic
1048823529 8:138400930-138400952 AGAGATCTTAAAATGGTTGATGG - Intronic
1050038007 9:1457852-1457874 AAAAATCTTAAATTGATTGATGG - Intergenic
1050467645 9:5946862-5946884 AAAGATCTCAAAATGTTTTAGGG - Intronic
1050467652 9:5947010-5947032 AGAGATCTCAAAATGTTTTAGGG - Intronic
1052160403 9:25250574-25250596 AGAGTTCTGGAGATGGTTGATGG + Intergenic
1053679758 9:40477622-40477644 AGAAATATTAAAATGGTTGCAGG - Intergenic
1053929751 9:43105954-43105976 AGAAATATTAAAATGGCTGCAGG - Intergenic
1054283962 9:63147318-63147340 AGAAATATTAAAATGGTTGCAGG + Intergenic
1054292839 9:63313158-63313180 AGAAATATTAAAATGGTTGCAGG - Intergenic
1054390857 9:64617638-64617660 AGAAATATTAAAATGGTTGCAGG - Intergenic
1054504864 9:65898676-65898698 AGAAATATTAAAATGGTTGCAGG + Intergenic
1056983832 9:91342514-91342536 AGTGATCTTAAAAAAGTTAATGG - Intronic
1057256372 9:93551139-93551161 AGGGATTTTATAATAGTTGAGGG - Intronic
1058219592 9:102280922-102280944 AGAAACCTTAAAAAGGTAGAGGG + Intergenic
1187469728 X:19558509-19558531 TGATATTTTAAAATGGATGATGG - Intronic
1187765523 X:22637465-22637487 AGAGATGTTAAGAAGGTTGATGG + Intergenic
1188336126 X:28935532-28935554 AGAGAACTTTAAATGGTTTATGG + Intronic
1190332063 X:49242227-49242249 AGAGGTGGTAAAAAGGTTGATGG + Intronic
1190409332 X:50119513-50119535 AGGGATTTGAAAGTGGTTGAAGG - Intergenic
1192188421 X:68974487-68974509 AAAAATCTTAAAATGTGTGATGG + Intergenic
1193919281 X:87406153-87406175 TGAGAACTTAAAATGGTTGAAGG + Intergenic
1195028739 X:100905396-100905418 CCAGATCTTAAACTTGTTGAGGG + Intergenic
1195527226 X:105905275-105905297 AGAGAGCTTCCAAGGGTTGAAGG - Exonic
1195899419 X:109781990-109782012 AGTGATCTAAAAATGATTGCTGG - Intergenic
1196385852 X:115149414-115149436 ATAGTTCTGAAAATGCTTGAGGG - Intronic
1197110634 X:122770171-122770193 AGAGATTTTAAAATTGGTGGTGG - Intergenic